tag:theconversation.com,2011:/africa/topics/dna-testing-8111/articlesDNA testing – The Conversation2023-09-11T12:34:41Ztag:theconversation.com,2011:article/2047302023-09-11T12:34:41Z2023-09-11T12:34:41ZCan animals give birth to twins?<figure><img src="https://images.theconversation.com/files/535718/original/file-20230705-25-ey6m80.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">Some animals, including goats, regularly give birth to two babies at once.</span> <span class="attribution"><a class="source" href="https://www.gettyimages.com/detail/photo/two-kid-goats-in-field-royalty-free-image/71919552?phrase=baby+goats&adppopup=true">Image Source via Getty Images</a></span></figcaption></figure><figure class="align-left ">
<img alt="" src="https://images.theconversation.com/files/281719/original/file-20190628-76743-26slbc.png?ixlib=rb-1.1.0&q=45&auto=format&w=237&fit=clip" srcset="https://images.theconversation.com/files/281719/original/file-20190628-76743-26slbc.png?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=293&fit=crop&dpr=1 600w, https://images.theconversation.com/files/281719/original/file-20190628-76743-26slbc.png?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=293&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/281719/original/file-20190628-76743-26slbc.png?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=293&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/281719/original/file-20190628-76743-26slbc.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=368&fit=crop&dpr=1 754w, https://images.theconversation.com/files/281719/original/file-20190628-76743-26slbc.png?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=368&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/281719/original/file-20190628-76743-26slbc.png?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=368&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption"></span>
</figcaption>
</figure>
<p><em><a href="https://theconversation.com/us/topics/curious-kids-us-74795">Curious Kids</a> is a series for children of all ages. If you have a question you’d like an expert to answer, send it to <a href="mailto:curiouskidsus@theconversation.com">curiouskidsus@theconversation.com</a>.</em></p>
<hr>
<blockquote>
<p><strong>Can animals give birth to twins? – Mia C., age 10</strong></p>
</blockquote>
<hr>
<p>Ask any parent – welcoming a new baby to the family is exciting, but it comes with a lot of work. And when the new addition is a pair of babies – twins – parents really have their work cut out for them.</p>
<p>For many animal species it’s the norm to have multiple babies at once. A litter of <a href="https://www.researchgate.net/profile/Jean-Pierre-Bidanel/publication/249324578_An_overview_of_twenty_years_of_selection_for_litter_size_in_pigs_using_hyperprolific_schemes/links/54525ccd0cf2cf51647a125b/An-overview-of-twenty-years-of-selection-for-litter-size-in-pigs-using-hyperprolific-schemes.pdf">piglets can be as many as 11</a> or more! </p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/538767/original/file-20230721-6326-u8u6fj.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="A mother pig lying on hay in a barn surrounded by multiple piglets" src="https://images.theconversation.com/files/538767/original/file-20230721-6326-u8u6fj.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/538767/original/file-20230721-6326-u8u6fj.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=489&fit=crop&dpr=1 600w, https://images.theconversation.com/files/538767/original/file-20230721-6326-u8u6fj.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=489&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/538767/original/file-20230721-6326-u8u6fj.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=489&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/538767/original/file-20230721-6326-u8u6fj.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=615&fit=crop&dpr=1 754w, https://images.theconversation.com/files/538767/original/file-20230721-6326-u8u6fj.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=615&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/538767/original/file-20230721-6326-u8u6fj.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=615&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Pigs are one species that gives birth to large litters.</span>
<span class="attribution"><a class="source" href="https://www.gettyimages.com/detail/photo/mother-pig-with-piglets-royalty-free-image/164283190?phrase=pig+litter&adppopup=true">Arthur Dries/DigitalVision via Getty Images</a></span>
</figcaption>
</figure>
<p><a href="https://www.vetmed.msstate.edu/directory/mhj95">We are</a> <a href="https://www.vetmed.msstate.edu/directory/tj1232">faculty members</a> at Mississippi State University College of Veterinary Medicine. We’ve been present for the births of many puppies and kittens over the years – and the animal moms almost always deliver multiples.</p>
<p>But are all those animal siblings who share the same birthday twins?</p>
<h2>Twins are two peas in a pod</h2>
<p><a href="https://www.britannica.com/science/multiple-birth">Twins are defined as two offspring</a> from the same pregnancy.</p>
<p>They can be identical, which means a single sperm fertilized a single egg that divided into two separate cells that went on to develop into two identical babies. They share the same DNA, and that’s why the two twins are essentially indistinguishable from each other.</p>
<p><a href="https://www.britannica.com/science/dizygotic-twin">Twins can also be fraternal</a>. That’s the outcome when two separate eggs are fertilized individually at the same time. Each twin has its own set of genes from the mother and the father. One can be male and one can be female. Fraternal twins are basically as similar as any set of siblings.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/538761/original/file-20230721-25-9rs8a7.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="diagram of two sperm fertilizing two eggs yielding two embryos, and one sperm fertilizing one egg that divides into two separate embryos" src="https://images.theconversation.com/files/538761/original/file-20230721-25-9rs8a7.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/538761/original/file-20230721-25-9rs8a7.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=156&fit=crop&dpr=1 600w, https://images.theconversation.com/files/538761/original/file-20230721-25-9rs8a7.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=156&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/538761/original/file-20230721-25-9rs8a7.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=156&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/538761/original/file-20230721-25-9rs8a7.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=196&fit=crop&dpr=1 754w, https://images.theconversation.com/files/538761/original/file-20230721-25-9rs8a7.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=196&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/538761/original/file-20230721-25-9rs8a7.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=196&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Fraternal twins originate in two eggs fertilized separately, while identical twins originate in a single fertilized egg that divides to create two embryos.</span>
<span class="attribution"><a class="source" href="https://www.gettyimages.com/detail/illustration/dizygotic-and-monozygotic-twins-illustration-royalty-free-illustration/1042127200?phrase=fertilization+of+twins+identical+vs+fraternal+diagram&adppopup=true">Veronika Zakharova/Science Photo Library via Getty Images</a></span>
</figcaption>
</figure>
<p>Approximately <a href="https://www.ncbi.nlm.nih.gov/books/NBK493200/#:%7E:text=Twin%20births%20account%20for%20approximately,percent%20of%20all%20twin%20gestations.">3% of human pregnancies in the United States produce twins</a>. Most of those are fraternal – approximately <a href="https://alphabiolabsusa.com/learning-center/identical-vs-fraternal-twins/">one out of every three pairs of twins</a> is identical.</p>
<h2>Multiple babies from one animal mom</h2>
<p>Each kind of animal has its own standard number of offspring per birth. People tend to know the most about domesticated species that are kept as pets or farm animals.</p>
<p>One study that surveyed the <a href="https://doi.org/10.1016/j.theriogenology.2010.10.034">size of over 10,000 litters among purebred dogs</a> found that the average number of puppies varied by the size of the dog breed. Miniature breed dogs – like chihuahuas and toy poodles, generally weighing less than 10 pounds (4.5 kilograms) – averaged 3.5 puppies per litter. Giant breed dogs – like mastiffs and Great Danes, typically over 100 pounds (45 kilograms) – averaged more than seven puppies per litter.</p>
<p>When a litter of dogs, for instance, consists of only two offspring, people tend to refer to the two puppies as twins. Twins are the <a href="https://doi.org/10.4141/cjas95-022">most common pregnancy outcome in goats</a>, though mom goats can give birth to a single-born kid or larger litters, too. Sheep frequently have twins, but <a href="https://doi.org/10.1016/j.smallrumres.2013.05.018">single-born lambs are more common</a>.</p>
<p>Horses, which are pregnant for 11 to 12 months, and cows, which are pregnant for nine to 10 months, tend to have just one foal or calf at a time – but twins may occur. Veterinarians and ranchers have long believed that it would be financially beneficial to encourage the conception of twins in dairy and beef cattle. Basically the farmer would get two calves for the price of one pregnancy.</p>
<p>But twins in cattle may result in <a href="https://doi.org/10.2527/jas.2007-0210">birth complications for the cow and undersized calves</a> with reduced survival rates. Similar risks come with <a href="https://doi.org/10.1016/j.theriogenology.2021.09.018">twin pregnancies in horses</a>, which tend to lead to both pregnancy complications that may harm the mare and the birth of weak foals.</p>
<h2>DNA holds the answer to what kind of twins</h2>
<p>So plenty of animals can give birth to twins. A more complicated question is whether two animal babies born together are identical or fraternal twins.</p>
<p>Female dogs and cats <a href="https://doi.org/10.1146/annurev.es.04.110173.001035">ovulate multiple eggs at one time</a>. Fertilization of individual eggs by distinct spermatazoa from a male produces multiple embryos. This process results in puppies or kittens that are fraternal, not identical, even though they may look very much the same.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/538776/original/file-20230721-6732-s8he64.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="A mother cat lying down on a blanket and nursing her kittens." src="https://images.theconversation.com/files/538776/original/file-20230721-6732-s8he64.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/538776/original/file-20230721-6732-s8he64.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/538776/original/file-20230721-6732-s8he64.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/538776/original/file-20230721-6732-s8he64.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/538776/original/file-20230721-6732-s8he64.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/538776/original/file-20230721-6732-s8he64.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/538776/original/file-20230721-6732-s8he64.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Though born from the same litter, these kittens all have different sets of genes.</span>
<span class="attribution"><a class="source" href="https://www.gettyimages.com/detail/photo/mother-cat-nursing-baby-kittens-royalty-free-image/1070428270?phrase=litter+of+kittens&adppopup=true">bozhdb/iStock via Getty Images</a></span>
</figcaption>
</figure>
<p>Biologists believe that identical twins in most animals are very rare. The tricky part is that lots of animal siblings look very, very similar and researchers need to do a DNA test to confirm whether two animals do in fact share all their genes. Only <a href="https://doi.org/10.1111/rda.12746">one documented report</a> of identical twin dogs was confirmed by DNA testing. But no one knows for sure how frequently fertilized animal eggs split and grow into identical twin animal babies.</p>
<p>And reproduction is different in various animals. For instance, nine-banded armadillos normally <a href="https://doi.org/10.1656/1528-7092(2002)001%5B0287:PVWABL%5D2.0.CO;2">give birth to identical quadruplets</a>. After a mother armadillo releases an egg and it becomes fertilized, it splits into four separate identical cells that develop into identical pups. Its relative, the seven-banded armadillo, can give birth to anywhere from <a href="https://doi.org/10.7717/peerj.3650">seven to nine identical pups at one time</a>.</p>
<p>There’s still a lot that scientists aren’t sure about when it comes to twins in other species. Since DNA testing is not commonly performed in animals, no one really knows how often identical twins are born. It’s possible – maybe even likely – that identical twins may have been born in some species without anyone’s ever knowing.</p>
<hr>
<p><em>Hello, curious kids! Do you have a question you’d like an expert to answer? Ask an adult to send your question to <a href="mailto:curiouskidsus@theconversation.com">CuriousKidsUS@theconversation.com</a>. Please tell us your name, age and the city where you live.</em></p>
<p><em>And since curiosity has no age limit – adults, let us know what you’re wondering, too. We won’t be able to answer every question, but we will do our best.</em></p><img src="https://counter.theconversation.com/content/204730/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>The authors do not work for, consult, own shares in or receive funding from any company or organization that would benefit from this article, and have disclosed no relevant affiliations beyond their academic appointment.</span></em></p>Animals often give birth to litters of more than one offspring at a time. But are those babies twins?Michael Jaffe, Associate Professor of Small Animal Surgery, Mississippi State UniversityTracy Jaffe, Assistant Clinical Professor of Veterinary Medicine, Mississippi State UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1992662023-04-23T14:54:08Z2023-04-23T14:54:08ZDoes our DNA really determine our intelligence and health?<p>In a recent article <a href="https://www.nature.com/articles/s41588-022-01242-5">from Nature Genetics_</a>, scientists raise concerns over the social impacts of recent advances in genomics - i.e. the study of genomes, or in other words, the genetic material of an individual or species. In passages bringing to mind the <a href="https://www.youtube.com/watch?v=W_KruQhfvW4">dystopian sci-fi film <em>Gattaca</em></a>, they describe a near future in which one’s DNA could foretell one’s physical and intellectual abilities and near-perfect children be conceived <em>in vitro</em>.</p>
<p>Indeed, on the surface, it would appear reality is catching up with fiction. We now live in a world where it is now possible to look at the entire genome in a bid to identify the genetic causes of complex diseases. Recent research in genome-wide association studies (GWAS) claims to have pinned down the genetic variants responsible for developing diseases or traits such as drug addiction, antisocial behaviour or intellectual aptitudes.</p>
<p>However, these views are flawed because they are based on a series of errors and misunderstandings; we will now proceed to unpacking them. </p>
<h2>What is a GWAS?</h2>
<p>GWAS seek to highlight differences in allele frequency of markers depending on the expression of the studied trait. The markers can be considered as small flags planted along the genome, each flag having two possible colours (the alleles). The idea behind GWAS is that an association between a marker and a trait allows for the detection of genetic factors independently of environmental factors. This can be done both on quantitative traits (such as height) and diseases.</p>
<p>In the latter case, scientists compare markers between groups of affected and healthy individuals. Each identified marker is then assigned a coefficient that is supposed to represent the strength of its association with the disease. An overall score - known as the <em>Polygenic Risk Score</em> - is finally calculated to represent the level of risk of developing the disease in question.</p>
<figure>
<iframe width="440" height="260" src="https://www.youtube.com/embed/W_KruQhfvW4?wmode=transparent&start=0" frameborder="0" allowfullscreen=""></iframe>
<figcaption><span class="caption">The trailer of the 1997 American dystopian science fiction thriller film, <em>Gattaca</em>.</span></figcaption>
</figure>
<h2>A new market</h2>
<p>As early as 2007, companies began selling disease risk predictions based on saliva samples. Located in South San Francisco, the biotech and genomics company 23andMe collected over a million DNA samples before being ordered by the FDA in <a href="https://www.businessinsider.com/fda-sends-warning-letter-to-23andme-2013-11?r=US&IR=T">2013</a> to cease its activities for want of clinical evidence.</p>
<p>23andMe managed to keep its doors open by changing its approach and collecting DNA to map out the geographical origins of people’s ancestors. An important part of these DNAs has been made available to scientific teams, allowing them to perform and publish GWAS on huge samples. Initially carried out on hundreds of individuals, GWAS rapidly expanded to millions of people. In the past fifteen years, many studies have claimed to have detected genetic factors that could predict not only our risk of disease, but also our intellectual abilities or social adaptation.</p>
<p>For example, a 2018 <a href="https://www.nature.com/articles/s41588-018-0152-6">study</a> on the educational achievements of nearly 270,000 individuals said it had identified more than a thousand genetic factors responsible for “intelligence”. Four years later, a study based on <a href="https://www.nature.com/articles/s41588-022-01016-z">3 million individuals</a> found the number of genetic factors multiplied by 4. In this spirit, a simple DNA swab would be enough to predict the number of years we were destined to study or <a href="https://www.nature.com/articles/s41586-022-05477-4">whether we would end up as serial smokers or alcoholics</a>.</p>
<h2>The mistaken assumptions behind Polygenic Risk Scores</h2>
<p>The problem is that these conclusions are based on erroneous assumptions and misinterpretation of associations between the traits to be predicted and genetic markers.</p>
<p>Indeed, Polygenic Risk Scores are specifically based on assumptions put forward in 1965 by <a href="https://onlinelibrary.wiley.com/doi/10.1111/j.1469-1809.1965.tb00500.x">Douglas Scott Falconer</a>. Among these hypotheses, it is excluded from the outset that an environmental factor can play an important role in the expression of the trait, even though we know how much lifestyle choices can impact our health. Environmental factors are also thought to impact the individual at random - regardless of their family, social and professional conditions. Last but not least, it is assumed that the pathological processes at the root of the disease are the same for all, when we know that all diseases are very heterogeneous.</p>
<h2>Misinterpretations of the GWAS studies</h2>
<p>Another problem is that Polygenic Risk Scores are based on a flawed interpretation of the GWAS studies. For if the link between a trait and genetic marker could indeed indicate a genetic factor, this remains to be confirmed by subsequent family and functional studies. Associations could just as well reflect environmental or cultural factors.</p>
<p>For example, a GWAS study comparing people in France who consume salted butter with those who consume unsalted butter would show a large number of genetic markers associated with this trait. Not because it would reveal genetic factors conferring a particular taste for salted butter, but because these markers differ between Brittany and other French regions. The problem of interpreting associations also arises for traits that are due to complex interactions between genetic and environmental factors. For example, associations observed between markers and body mass index (BMI) may reflect sociocultural differences, particularly differences in eating habits. This will also be the case for all diseases associated with BMI (diabetes, cardiovascular diseases, breast cancer etc.).</p>
<figure class="align-center ">
<img alt="" src="https://images.theconversation.com/files/507620/original/file-20230201-14-eonm5f.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/507620/original/file-20230201-14-eonm5f.png?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=259&fit=crop&dpr=1 600w, https://images.theconversation.com/files/507620/original/file-20230201-14-eonm5f.png?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=259&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/507620/original/file-20230201-14-eonm5f.png?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=259&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/507620/original/file-20230201-14-eonm5f.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=326&fit=crop&dpr=1 754w, https://images.theconversation.com/files/507620/original/file-20230201-14-eonm5f.png?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=326&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/507620/original/file-20230201-14-eonm5f.png?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=326&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Example of a graphical representation of a GWAS study of kidney stones.</span>
<span class="attribution"><a class="source" href="https://commons.wikimedia.org/wiki/File:Manhattan_plot_from_a_GWAS_of_kidney_stone_disease.png">Sarah A. Howles/Wikipedia</a>, <a class="license" href="http://creativecommons.org/licenses/by/4.0/">CC BY</a></span>
</figcaption>
</figure>
<p>These false conclusions have serious consequences, as clinicians increasingly turn to risk calculation tools based on these scores.</p>
<h2>Sociological consequences</h2>
<p><a href="https://www.science.org/doi/10.1126/science.1198102">Already denounced in 1975 by Marcus Feldman and Richard Lewontin</a> and in 1978 <a href="https://eudml.org/doc/198864">by Albert Jacquard</a>, the fanciful interpretations of the Intelligence Quotient (IQ) have resurfaced with the idea that your IQ can be predicted from birth based on your DNA.</p>
<p>The IQ variable was originally thought out as a tool to measure the adequacy of a child to a given school programme. It is not a universal and timeless measure of cognitive abilities, or even of intelligence. Even if we restrict ourselves to France, we cannot compare the mental arithmetic performance of children aged 9 today with those of a century ago, for the simple reason that they were not trained in the same way.</p>
<p>Unfortunately, many so-called “socio-genomic” studies are advancing the idea that we are genetically predetermined to perform well or poorly in school. These ideas are widely disseminated by the scientific press, the mainstream media and books by psychologists such as <a href="https://press.princeton.edu/books/hardcover/9780691190808/the-genetic-lottery">Paige Harden</a> and <a href="https://mitpress.mit.edu/9780262039161/blueprint/">Plomin</a>. In light of these ideas, we would be forgiven for asking ourselves about the point of promoting education for all when some are, so to speak, “genetically impervious”.</p>
<h2>Ethical implications</h2>
<p>Polygenic scores are also used by some to differentiate populations according to traits such as intelligence, thereby justifying racist views or eugenic behaviour.</p>
<p>For example, in the <a href="https://www.sciencedirect.com/science/article/abs/pii/S0160289615001087">journal “Intelligence ”</a> , after comparing IQ score of different geographical areas, the author concluded that the genetic factors contributing to intelligence had been subjected to selection pressure during migration and would explain a higher intelligence in the European population than in the African population.</p>
<p>In his presidential address to the American Society of Human Genetics in 2015 [https://pubmed.ncbi.nlm.nih.gov/26942276/ref], geneticist Neil Risch mischievously commented the approach and conclusions. He calculated the scores of Craig Venter (pioneer of human genome sequencing) and James Watson (co-discoverer of the DNA structure). The result was that both have a score below the European average. Risch humorously concluded that a below-average score was enough to land a Nobel Prize or the Medal of Science.</p>
<h2>A flawed genetic model</h2>
<p>In addition to Nature Genetics, journals such as <a href="https://gwern.net/doc/genetics/selection/artificial/2023-meyer.pdf">Science</a>, or <a href="https://www.ashg.org/">societies devoted to human genetics</a> appear rightly concerned about the slippery slope toward genetic determinism we find ourselves on. But they merely raise ethical issues, failing to stress, in the process, that the root of the problem remains an inappropriate genetic model and the misinterpretation of associations with genetic markers.</p>
<p>It would be easy to caricature the scientific debate by labelling those who question the validity of genetic predictions as ‘environmentalists’. Yet to deny the validity of genetic predictions of complex traits is not to deny the effect of genetic factors on these traits. Rather, it is to <a href="https://www.mdpi.com/2075-4426/12/8/1266">challenge the assumptions on which these predictions are based</a>.</p>
<p>On a more positive note, these concerning developments should not obscure the valuable contribution of these new technologies when deployed correctly. In particular, studies described as “ post-GWAS ” have made it possible to highlight the role of certain genes or gene networks in diseases whose causes remain difficult to pin down <a href="https://pubmed.ncbi.nlm.nih.gov/34689168/">(cancers, neurological diseases…)</a>.</p><img src="https://counter.theconversation.com/content/199266/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Les auteurs ne travaillent pas, ne conseillent pas, ne possèdent pas de parts, ne reçoivent pas de fonds d'une organisation qui pourrait tirer profit de cet article, et n'ont déclaré aucune autre affiliation que leur organisme de recherche.</span></em></p>New genetic studies claim to be able to foretell our intelligence or predisposition to certain diseases. But two scientists beg to disagree, reminding us that not everything is written in our DNA.Françoise Clerget-Darpoux, Directeur de recherches émérite en génétique statistique, InsermEmmanuelle Genin, Directrice de Recherche en génétique statistique et des populations, InsermLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1968182022-12-29T11:32:28Z2022-12-29T11:32:28ZBasmati rice: the new authenticity rules aiming to remove sub-standard varieties from the market<figure><img src="https://images.theconversation.com/files/501900/original/file-20221219-18-vgq8iz.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">Giving a whole new meaning to dodgy curry. </span> <span class="attribution"><a class="source" href="https://www.shutterstock.com/image-photo/cooked-plain-white-basmati-rice-served-356954813">StockImageFactory.com</a></span></figcaption></figure><p>Basmati is the most popular speciality rice in the UK, adding extra flavour and subtlety to everything from curries to pilafs to kedgerees. <a href="https://static.wixstatic.com/media/329f2f_ab27e15124aa4a44b3ecbfe5abedd390%7Emv2.jpg/v1/fill/w_657,h_848,al_c,q_85,enc_auto/2020%20Infographic_JPG.jpg">Nearly three-quarters</a> of the world’s basmati is produced in India, and the <a href="https://www.reuters.com/markets/commodities/indias-basmati-rice-exports-could-jump-15-key-buyers-stock-up-2022-11-30/">UK buys 3%</a> of it – plus substantial amounts from the second-largest producer, Pakistan. </p>
<p>All has not been well with this delicious staple, however. A huge number of newly cultivated varieties have been permitted in the UK and EU since 2017, and some have turned out to be sub-standard, lacking the unique popcorn-like fragrance that helps to make this rice so sought after. </p>
<p><a href="https://www.riceassociation.org.uk/_files/ugd/329f2f_9ecdd5484ff94aed9998d506b11e77a5.pdf">New rules</a> are being introduced at the beginning of 2023 that aim to take these lesser varieties of basmati off the market. So will this solve the problem?</p>
<h2>Basmati and the code of practice</h2>
<p>Basmati rice has been cultivated for thousands of years in the fertile alluvial plains between the Indus and Ganges rivers. To qualify as basmati, grains must meet certain standards related to things like fragrance, grain length and width, as well as cooked texture. They must also have a mid-range level of amylose, a part of the starch in rice. </p>
<p>Fraudsters nevertheless became notorious for cutting basmati with lesser rice grains, drawn by the fact that it is up to 50% more expensive per kilo. Several decades ago, it wasn’t uncommon for imported basmati to be more than 50% impure. </p>
<p>To get around this problem, the <a href="https://www.riceassociation.org.uk/">UK Rice Association</a> introduced a <a href="https://ricenewstoday.com/wp-content/uploads/2017/03/Code-of-Practice-on-Basmati-Rice-by-BRC-UK.pdf">code of practice in 2005</a>. Also followed across the EU, the code specified that basmati could be no more than 7% impure, as well as introducing a list of 15 permitted varieties: nine traditional ones that could be imported duty free and a further six that were modern cultivars. We at Bangor University devised the system of DNA fingerprinting that is used to enforce the code and has sometimes led to <a href="https://www.newscientist.com/article/mg19225771-900-buyer-beware-the-rise-of-food-fraud/">prosecutions for infringements</a>. </p>
<p>The system worked well <a href="https://ricenewstoday.com/wp-content/uploads/2017/07/Revised-Code-of-Practice-on-Basmati-Rice-by-BRC-UK.pdf">until 2017</a>, when the code was updated to add 25 new modern cultivars. This followed an explosion in new breeding in the 2000s and 2010s to address the problem that traditional basmati varieties are tall, low-yielding plants which fall over if they are fed with too much fertiliser. Breeders overcame this by using crossing and selection to add the so-called <a href="https://www.pnas.org/doi/10.1073/pnas.132266399">“green revolution” semi-dwarfing gene</a>, which is also bred into most other modern rice varieties. </p>
<p>India and Pakistan had successfully persuaded the UK and EU that these 25 new varieties were as high in quality as the existing 16, but several years later we were able to show that this wasn’t entirely right. </p>
<p>By developing alternative <a href="https://link.springer.com/article/10.1007/s12161-020-01892-3">DNA markers for fingerprinting</a>, we showed that six of the new varieties – five from India and one from Pakistan – had not been properly bred for fragrance. Some did not even contain the version of the <em>BADH2</em> gene that makes basmati fragrance possible in the first place. Although India and Pakistan have rigorous systems for testing rice quality, they don’t necessarily do the gene testing that would have picked up the problem. </p>
<h2>The future</h2>
<p>The Rice Association has responded to this discovery by publishing a new code of practice that removes the six varieties from the permitted list. Coming into force on January 1, the code also adds five new varieties that do pass muster. As a result, consumers should once again be able to buy basmati rice in the knowledge that it is of the highest possible quality. </p>
<p>But this isn’t the end of the story. For one thing, the 7% impurity rule remains. I have long argued that the Rice Association should adopt the same 1% rule that applies in many products – <a href="https://www.food.gov.uk/sites/default/files/media/document/GM-Animal-Feed-EC-Regulation-Notes-1829-2003-1830-2003.pdf">non-GM foods</a>, for example. There’s no real reason for the basmati exception, and it is also arguably easier to enforce a 1% rule because of the way that DNA testing works. </p>
<p>Secondly, rice breeding is not standing still. Breeders have started focusing on making crosses to allow basmati varieties to inherit genes that will mean they need less fertiliser, resist disease so they need fewer or no pesticides, and even withstand drier growing conditions or salt-contaminated soils. </p>
<p>These varieties aren’t quite ready to hit the market but are urgently needed to increase the sustainability of rice production. But if such varieties are to be sold labelled “basmati”, they too will have to be monitored to ensure they meet the same high standards that consumers expect. The same goes for varieties created by gene editing, which have not yet started emerging but probably will do over the next couple of decades. </p>
<p>If we don’t maintain today’s standards, it may harm the industry – and crucially the farmers who work so hard to produce this beautiful rice in the first place. It’s an interesting case study in how cutting edge technology and the right regulation can ensure that an ancient industry remains fit for purpose in the 21st century.</p><img src="https://counter.theconversation.com/content/196818/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Katherine Steele has received funding for Bangor University from Defra, UKRI and The Food Standards Agency. </span></em></p>Some versions that were permitted in 2017 don’t have the fragrance that we know and love.Katherine Steele, Senior Lecturer in Sustainable Crop Production, Bangor UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1943492022-11-29T03:25:33Z2022-11-29T03:25:33ZAt-home DNA tests just aren’t that reliable – and the risks may outweigh the benefits<figure><img src="https://images.theconversation.com/files/497801/original/file-20221129-12-tti4co.jpeg?ixlib=rb-1.1.0&rect=38%2C71%2C3650%2C2809&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">
</span> <span class="attribution"><span class="source">Shutterstock</span></span></figcaption></figure><p>The field of genomic science is rapidly advancing, with commercial genetic tests becoming <a href="https://www.globenewswire.com/news-release/2022/04/13/2421920/0/en/DNA-Test-Kits-Market-to-Cross-US-2-7-Bn-Mark-by-2030-TMR-Report.html">affordable and popular</a>. </p>
<p>Taking these tests is simple. The company sends you a collection kit. You send it back with a saliva sample or cheek swab. The sample is sequenced and analysed, and before long you have your results.</p>
<p>However, upon a closer look you’ll find commercial genetic tests come with several hidden risks, and consumers often don’t understand what they’re signing up for. Here are some important factors to consider if you’re thinking of getting one.</p>
<h2>Ancestry tests</h2>
<p>The most common personal genomics tests are ancestry tests, offered by companies including <a href="https://www.ancestry.com.au">Ancestry</a>, <a href="https://www.cnbc.com/2022/01/25/how-one-of-googles-earliest-genetic-experiments-23andme-paid-off.html">23andMe</a>, <a href="https://www.familytreedna.com">FamilyTreeDNA</a> and <a href="https://www.myheritage.com/index.php">MyHeritage</a>. </p>
<p>Ancestry tests are marketed as a way to explore your ancestral origins. But since different companies use different methods, and even different “ethnicity” categorisations, you may get <a href="https://gizmodo.com/how-dna-testing-botched-my-familys-heritage-and-probab-1820932637">inconsistent results</a>. For example, Kristen V. Brown wrote <a href="https://gizmodo.com/how-dna-testing-botched-my-familys-heritage-and-probab-1820932637">for Gizmodo about</a> how her saliva sample produced three different results from AncestryDNA, 23andMe and National Geographic. </p>
<p>In another example, a 2019 CBC Marketplace <a href="https://www.cbc.ca/news/science/dna-ancestry-kits-twins-marketplace-1.4980976">experiment involved</a> sending the DNA of identical twins to five different companies. Each company returned surprisingly different results. Mark Gerstein, a Yale University bioinformatics expert, suspected the differences came down to different algorithms being used to process the raw data. </p>
<h2>Health tests</h2>
<p>The industry also offers tests for a variety of health conditions. A test may claim to provide you with predictions of your risk of developing breast cancer or Alzheimer’s. Carrier tests indicate whether you’re likely to pass on a particular condition to your child.</p>
<p>But users can get contradictory results here too. One company might indicate you’re at a heightened risk of colon cancer, while another might say you have reduced risk. Not to mention genes are only one factor in most complex diseases.</p>
<p>In an investigation by the US Government Accountability Office, tests from four companies delivered highly <a href="https://www.gao.gov/assets/gao-10-847t.pdf">varied results</a>. The report concluded:</p>
<blockquote>
<p>The test results we received are misleading and of little or no practical use to consumers. […] The experts we spoke with agreed that the companies’ claims and test results are both ambiguous and misleading.</p>
</blockquote>
<p>A genetic test in a medical clinic is governed by many rules and laws. A commercial test bought online is mostly subject to the company’s own terms and conditions and privacy policy. And, as we all know, these terms and conditions are often <a href="https://www.forbrukerradet.no/side/250000-words-of-app-terms-and-conditions/">too long</a> and unreadable for most people.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/research-shows-most-online-consumer-contracts-are-incomprehensible-but-still-legally-binding-110793">Research shows most online consumer contracts are incomprehensible, but still legally binding</a>
</strong>
</em>
</p>
<hr>
<h2>Low predictive value</h2>
<p>Another type of test is a “<a href="https://journals.physiology.org/doi/full/10.1152/physiolgenomics.00104.2015">talent test</a>”, which purports to tell parents whether their child will have a high IQ, or excel in certain activities such as music or sport. These tests aren’t validated – and for many talents there’s <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5034400/">no strong evidence</a> genes play a key role in their development.</p>
<p>Regarding talent tests for “sporting ability,” <a href="https://www.sports-injury-physio.com/post/genetic-dna-testing-sport">a consensus statement</a> published in the British Medical Journal of Sports Medicine said:</p>
<blockquote>
<p>[…] the consensus is that the predictive value of such tests in the context of training responses or talent identification in sport is virtually zero.</p>
</blockquote>
<p>Yet talent tests are growing in popularity, <a href="https://www.afr.com/companies/healthcare-and-fitness/chinese-parents-test-babies-dna-to-discover-their-talents-20191125-p53dqv">especially in China</a>. What’s particularly concerning is these tests may promote ideas of <a href="https://espace.library.uq.edu.au/data/UQ_4dffc30/geneticdeterminismandplace.pdf?Expires=1669678087&Key-Pair-Id=APKAJKNBJ4MJBJNC6NLQ&Signature=hnfszAD3nK5xmcLh1RIm4hIw2iKaclwVUgFcfy1Xopd5aU8B6bIKy-K0WoRew39P-PwwDH4lYO%7EjtZH78iSo7GkJeOh%7EInodh30JpY6RVwcrvSn-LnRLqq0aKLGJQOK0NM1qSMR91sV9%7EQ%7EUKD7i8yieNVtNYiMuLNyOCvovDzllXFhAqa62EJoi8qSUpdGSlIvxAD3Bmm9oGw4zXBaHAhRXJUkZoxKUbf%7EnfDeEPb2jdpv6Bsh%7EybFOt9HYrArJh-n2-gvR4IXek-PGrS-gWCqLlHrH%7ENBPT7po1XUsJhVpO8onmhTy62B1ez8BxsrhgnZ6o6Ef7MI9BKoPfBN81Q__">genetic determinism</a> – a flawed theory that suggests genes are the only reason we have certain abilities.</p>
<p>So-called “infidelity” tests are also highly problematic. With these, users can discreetly send in DNA samples of other people without their consent to supposedly find out whether their partner might be cheating.</p>
<p>Apart from being unethical and illegal in many countries (including Australia), the samples sent in would likely be taken from objects such as bed sheets or wine glasses, and are unlikely to be reliable. </p>
<h2>Inaccurate results are just the start of the problem</h2>
<p>Once your genetic data are in the hands of a company – with most market leaders based in the US – there’s a good chance they will stay there indefinitely. And unlike a bank PIN, you can’t just change your genetic code if something goes wrong. </p>
<p>Since we share a lot of our DNA with our relatives, disclosing our genomic data can create privacy risks for relatives, too. <a href="https://www.science.org/doi/10.1126/science.aau4832">One 2018 study</a> found many US citizens of European descent could be identified if their third cousin or closer had their DNA on an <a href="https://www.washingtonpost.com/science/2018/10/11/even-if-youve-never-taken-dna-test-distant-relatives-could-reveal-your-identity/">open-access or commercial database</a>.</p>
<p>Then there’s the risk of data breaches at DNA testing companies. <a href="https://www.komando.com/security-privacy/ancestry-com-suffers-big-data-leak-300000-user-credentials-exposed/435921/">AncestryDNA</a>, <a href="https://www.theverge.com/2018/6/5/17430146/dna-myheritage-ancestry-accounts-compromised-hack-breach">MyHeritage</a> and the genetic genealogy site <a href="https://cruwys.blogspot.com/2020/07/major-privacy-breach-at-gedmatch.html">GedMatch</a> have already been afflicted by such attacks.</p>
<p>Genetic information can also be used in criminal investigations, which means your data could be shared with <a href="https://www.nytimes.com/2020/08/01/technology/gedmatch-breach-privacy.html">law enforcement agencies</a>. FamilyTreeDNA has shared <a href="https://www.nytimes.com/2019/02/04/business/family-tree-dna-fbi.html">data with the FBI</a> in the past. Data can also be shared with <a href="https://globalnews.ca/news/4616715/ancestry-dna-test-deportation-cbsa/">immigration authorities</a> and other government entities that may use your (or your relative’s) data <a href="https://www.vice.com/en/article/y3pkgj/police-use-dna-phenotyping-to-limit-pool-of-suspects-to-15000">against you</a>. </p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/497791/original/file-20221128-16-1p0y08.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="Close up shot of a woman taking her own cheek swab" src="https://images.theconversation.com/files/497791/original/file-20221128-16-1p0y08.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/497791/original/file-20221128-16-1p0y08.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/497791/original/file-20221128-16-1p0y08.jpeg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/497791/original/file-20221128-16-1p0y08.jpeg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/497791/original/file-20221128-16-1p0y08.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/497791/original/file-20221128-16-1p0y08.jpeg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/497791/original/file-20221128-16-1p0y08.jpeg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Although most of the commercial DNA testing companies are based in America, they still service people in Australia and New Zealand.</span>
<span class="attribution"><span class="source">Shutterstock</span></span>
</figcaption>
</figure>
<p>Additionally, <a href="https://www.scmp.com/tech/science-research/article/1932838/igene-hong-kong-biotech-start-prenetics-bringing-48-hour-dna">insurance</a> companies may use someone’s genetic data to determine risks, coverage and premiums. In 2018 US biotech Orig3n <a href="https://www.crowdfundinsider.com/2018/08/137259-chinese-e-insurer-zhongan-has-teamed-up-with-biotech-company-orig3n-for-health-tech-solutions/">partnered with</a> Chinese e-insurance company ZhongAn Insurance.</p>
<p>Similarly, 23andMe has partnered with at least 14 <a href="https://venturebeat.com/business/23andme-has-signed-12-other-genetic-data-partnerships-beyond-pfizer-and-genentech/">pharmaceutical companies</a> to research a <a href="https://www.the-scientist.com/the-nutshell/23andme-genentech-partner-on-parkinsons-36114">range of diseases</a> and <a href="https://www.the-scientist.com/the-nutshell/23andme-genentech-partner-on-parkinsons-36114">develop new drugs</a>. Through such partnerships, businesses benefit from consumers’ data without compensating them.</p>
<h2>6 questions before clicking the purchase button</h2>
<p>The <a href="https://edinburghuniversitypress.com/book-buying-your-self-on-the-internet.html">lack of regulation</a> in the personal genomics industry means it’s impossible to predict how your genetic data might be used. Before you buy a test, or if you know someone who plans to, consider these questions: </p>
<ol>
<li><p>Given the sensitivity of the information and the risks involved, are you comfortable accepting the terms and conditions you (probably) haven’t read? </p></li>
<li><p>Many third parties may be interested in your genetic information. Are you happy for it to be shared with them? </p></li>
<li><p>Do you realise you don’t have the legal right to decide how long your personal data will be stored?</p></li>
<li><p>If you’re considering a test because of a health concern, did your doctor recommend it?</p></li>
<li><p>How would you respond if your ancestry results don’t match your sense of identity?</p></li>
<li><p>How would you feel if the company changed its policy and restricted your access to your own data?</p></li>
</ol>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/cousin-took-a-dna-test-courts-could-use-it-to-argue-you-are-more-likely-to-commit-crimes-129976">Cousin took a DNA test? Courts could use it to argue you are more likely to commit crimes</a>
</strong>
</em>
</p>
<hr>
<img src="https://counter.theconversation.com/content/194349/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Andelka M. Phillips has received funding from the Borrin Foundation to research the legal and policy implications of Consumer Data Rights in the context of genetic testing services. This article represents the authors views; the Borrin Foundation is not responsible for the content of this article and has not endorsed it.
</span></em></p><p class="fine-print"><em><span>Samuel Becher has received funding from the Borrin Foundation to research the legal and policy implications of Consumer Data Rights in the context of genetic testing services. This article represents the authors views; the Borrin Foundation is not responsible for the content of this article and has not endorsed it.</span></em></p>Commercial tests often provide inconsistent results. Here are six questions to ask yourself before you pay for one.Andelka M. Phillips, Senior Lecturer in Law, Science and Technology, The University of QueenslandSamuel Becher, Professor of Law, Te Herenga Waka — Victoria University of WellingtonLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1919372022-10-11T19:04:19Z2022-10-11T19:04:19ZDNA is often used in solving crimes. But how does DNA profiling actually work?<figure><img src="https://images.theconversation.com/files/488905/original/file-20221010-58507-19oz7r.jpg?ixlib=rb-1.1.0&rect=229%2C97%2C3604%2C2057&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">
</span> <span class="attribution"><span class="source">thinkhubstudio/Shutterstock</span></span></figcaption></figure><p>DNA profiling is frequently in the news. Public interest is sparked when DNA is used to <a href="https://www.abc.net.au/news/2010-07-29/dna-retesting-confirms-murderers-guilt/925028">identify a suspect</a> or <a href="https://www.smh.com.au/national/nsw/missing-sydney-fraudster-melissa-caddick-found-dead-on-nsw-south-coast-20210226-p5760e.html">human remains</a>, or <a href="https://www.npr.org/2022/09/08/1121542171/genealogy-dna-murder-stacey-lyn-chahorski-henry-frederick-wise-michigan-georgia">resolves a cold case</a> that seems all but forgotten.</p>
<p>Very occasionally, it is in the media when <a href="https://www.theguardian.com/australia-news/2022/oct/04/queensland-lab-could-have-tested-more-samples-from-scenes-for-less-than-1m-inquiry-hears">the process doesn’t work as it should</a>.</p>
<p>So what is DNA profiling and how does it work – and why does it sometimes not work?</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/australia-has-2-000-missing-persons-and-500-unidentified-human-remains-a-dedicated-lab-could-find-matches-90620">Australia has 2,000 missing persons and 500 unidentified human remains – a dedicated lab could find matches</a>
</strong>
</em>
</p>
<hr>
<h2>A short history of DNA profiling</h2>
<p>DNA profiling, as it has been known since 1994, has been used in the criminal justice system since the late 1980s, and was originally termed “DNA fingerprinting”.</p>
<p>The DNA in every human is very similar – up to <a href="https://www.genome.gov/about-genomics/fact-sheets/Genetics-vs-Genomics#:%7E:text=All%20human%20beings%20are%2099.9,about%20the%20causes%20of%20diseases.">99.9% identical</a>, in fact. But strangely, <a href="https://www.ucsf.edu/news/2017/02/405686/mysterious-98-scientists-look-shine-light-our-dark-genome">about 98% of the DNA in our cells</a> is not gene-related (i.e. has no known function).</p>
<p>This non-coding DNA is largely comprised of sequences of the four bases that make up the DNA in every cell.</p>
<figure class="align-center ">
<img alt="A simple chart showing the very basics of the structure of DNA" src="https://images.theconversation.com/files/489990/original/file-20221017-17-6vxi65.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/489990/original/file-20221017-17-6vxi65.png?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=600&fit=crop&dpr=1 600w, https://images.theconversation.com/files/489990/original/file-20221017-17-6vxi65.png?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=600&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/489990/original/file-20221017-17-6vxi65.png?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=600&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/489990/original/file-20221017-17-6vxi65.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=754&fit=crop&dpr=1 754w, https://images.theconversation.com/files/489990/original/file-20221017-17-6vxi65.png?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=754&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/489990/original/file-20221017-17-6vxi65.png?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=754&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">The four DNA bases are guanine, cytosine, thymine and adenine, forming G-C and T-A pairs.</span>
<span class="attribution"><span class="source">Shutterstock</span></span>
</figcaption>
</figure>
<p>But for reasons unknown, some sections of the sequence are repeated: an example is TCTATCTATCTATCTATCTA where the sequence TCTA is repeated five times. While the number of times this DNA sequence is repeated is constant within a person, it can vary between people. One person might have 5 repeats but another 6, or 7 or 8.</p>
<p>There are a large number of variants and all humans fall into one of them. The detection of these repeats is the bedrock of modern DNA profiling. A DNA profile is a list of numbers, based on the repeated sequences we all have.</p>
<p>The use of these short repeat sequences (the technical term is “<a href="https://nij.ojp.gov/topics/articles/what-str-analysis">short tandem repeat</a>” or STR) started in 1994 when the UK Forensic Science Service <a href="https://doi.org/10.1007/BF01224776">identified four of these regions</a>. The chance that two people taken at random in the population would share the same repeat numbers at these four regions was about 1 in 50,000.</p>
<p>Now, the number of known repeat sequences has expanded greatly, with the latest test looking at 24 STR regions. Using all of the known STR regions results in an infinitesimally small probability that any two random people have the same DNA profile. And herein lies the power of DNA profiling.</p>
<figure class="align-center ">
<img alt="A knife on the ground with the number five on a yellow card in the background" src="https://images.theconversation.com/files/488906/original/file-20221010-44863-e4tu0m.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/488906/original/file-20221010-44863-e4tu0m.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/488906/original/file-20221010-44863-e4tu0m.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/488906/original/file-20221010-44863-e4tu0m.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/488906/original/file-20221010-44863-e4tu0m.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/488906/original/file-20221010-44863-e4tu0m.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/488906/original/file-20221010-44863-e4tu0m.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Swabbing an item left at a crime scene can easily yield enough cells to generate a DNA profile.</span>
<span class="attribution"><span class="source">Fuss Sergey/Shutterstock</span></span>
</figcaption>
</figure>
<h2>How is DNA profiling performed?</h2>
<p>The repeat sequence will be the same in every cell within a person – thus, the DNA profile from a blood sample will be the same as from a plucked hair, inside a tooth, saliva, or skin. It also means a DNA profile will not in itself indicate from what type of tissue it originated.</p>
<p>Consider a knife alleged to be integral to an investigation. A question might be “who held the knife”? A swab (cotton or nylon) will be moistened and rubbed over the handle to collect any cells present.</p>
<p>The swab will then be placed in a tube containing a cocktail of chemicals that purifies the DNA from the rest of the cellular material – this is a highly automated process. The amount of DNA will then be quantified.</p>
<p>If there is sufficient DNA present, we can proceed to generate a DNA profile. The optimum amount of DNA needed to generate the profile is 500 picograms – this is really tiny and represents only 80 cells!</p>
<figure class="align-center ">
<img alt="A colourful chart on a screen with DNA base code underneath" src="https://images.theconversation.com/files/488901/original/file-20221010-58317-35ipe0.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/488901/original/file-20221010-58317-35ipe0.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=401&fit=crop&dpr=1 600w, https://images.theconversation.com/files/488901/original/file-20221010-58317-35ipe0.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=401&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/488901/original/file-20221010-58317-35ipe0.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=401&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/488901/original/file-20221010-58317-35ipe0.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=504&fit=crop&dpr=1 754w, https://images.theconversation.com/files/488901/original/file-20221010-58317-35ipe0.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=504&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/488901/original/file-20221010-58317-35ipe0.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=504&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">DNA profiling relies on finding repeated sequences in a sample.</span>
<span class="attribution"><span class="source">fotohunter/Shutterstock</span></span>
</figcaption>
</figure>
<h2>How foolproof is DNA profiling?</h2>
<p>DNA profiling is highly sensitive, given it can work from only 80 cells. This is microscopic: the tiniest pinprick of blood holds thousands of blood cells.</p>
<p>Consider said knife – if it had been handled by two people, perhaps including a legitimate owner and a person of interest, yet only 80 cells are present, those 80 cells would not be from only one person but two. Hence there is now a less-than-optimal amount of DNA from either of the people, and the DNA profiling will be a mixture of the two.</p>
<p>Fortunately, <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8535381/">there are several</a> types <a href="https://strmix.com/">of software</a> to pull apart these mixed DNA profiles. However, the DNA profile might be incomplete (the term for this is “partial”); with less DNA data, there will be a reduced power to identify the person.</p>
<p>Worse still, there may be insufficient DNA to generate any meaningful DNA profile at all. If the sensitivity of the testing is pushed further, we might obtain a DNA profile from even a few cells. But this could implicate a person who may have held the knife innocently weeks prior to an alleged event; or be from someone who shook hands with another person who then held the knife.</p>
<p>This later event is called “indirect transfer” and is something to consider with such small amounts of DNA.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/criminals-cant-easily-edit-their-dna-out-of-forensic-databases-96416">Criminals can't easily edit their DNA out of forensic databases</a>
</strong>
</em>
</p>
<hr>
<h2>What can’t DNA profiling do?</h2>
<p>In forensics, using DNA means comparing a profile from a sample to a reference profile, such as taken from a witness, persons of interest, or criminal DNA databases.</p>
<p>By itself, a DNA profile is a set of numbers. The only thing we can figure out is whether the owner of the DNA has a Y-chromosome – that is, their biological sex is male.</p>
<p>A standard STR DNA profile does not indicate anything about the person’s appearance, predisposition to any diseases, and very little about their ancestry.</p>
<p>Other types of DNA testing, such as ones used in genealogy, can be used to associate the DNA at a crime scene to potential genetic relatives of the person – but current standard STR DNA profiling will not link to anyone other that perhaps very close relatives – parents, offspring, or siblings.</p>
<p>DNA profiling has been, and will continue to be, an incredibly powerful forensic test to answer “whose biological material is this”? This is its tremendous strength. As to how and when that material got there, that’s for different methods to sort out.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/new-technology-lets-police-link-dna-to-appearance-and-ancestry-and-its-coming-to-australia-173334">New technology lets police link DNA to appearance and ancestry – and it's coming to Australia</a>
</strong>
</em>
</p>
<hr>
<img src="https://counter.theconversation.com/content/191937/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Adrian Linacre receives funding from the Attorney General's Department of South Australia</span></em></p>Modern DNA sampling is shockingly sensitive – you can get someone’s profile from just 80 cells.Adrian Linacre, Professor of Forensic Genetics, Flinders UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1831912022-08-04T15:56:59Z2022-08-04T15:56:59ZDNA test kits are changing donor-conceived families<figure><img src="https://images.theconversation.com/files/469777/original/file-20220620-24-tyqo2i.jpg?ixlib=rb-1.1.0&rect=20%2C0%2C6689%2C4476&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">DNA testing is becoming more popular</span> <span class="attribution"><a class="source" href="https://www.shutterstock.com/image-photo/young-attractive-female-scientist-protective-eyeglasses-707498413">Shutterstock</a></span></figcaption></figure><p>A law passed on April 1 2005 will have life-changing consequences for families across the UK from next year. </p>
<p>Anyone conceived from a donated sperm, egg or embryo from that day onward can find out the identity of their donor parents once they reach adulthood. This means that starting from late 2023, when the oldest of these people begin to turn 18, there could be a deluge of young people wishing to find out who their donor was. But thanks to at-home DNA testing, many donor-conceived people are already uncovering their biological origins in what can be an emotionally difficult process.</p>
<p>There were around 1,500 live births in the UK as a result of donated eggs or sperm in that first year the law was changed (April 1 2005 - March 31 2006). I can only imagine the meetings and the emotions, both wonderful and difficult, involved for families next year. </p>
<p>This will also be a watershed moment for the <a href="https://www.hfea.gov.uk">Human Fertility and Embryology Authority</a> (HFEA), the independent regulator that regulates fertility treatment (and research on human embryos) in the UK and will oversee this process. </p>
<p>But not all donor-conceived people will see the benefit of this law. Anyone conceived after August 1991 can only find out non-identifying information such as eye colour or country of birth of their donor. This was when the HFEA was created to record all uses of donated eggs, sperm and embryos in addition to regulating the UK’s licensed fertility clinics.</p>
<p>Before August 1991, fertility treatment was a bit of a wild west and anyone born before this period would have little chance ever finding out who their donor was. They have to wait for their donor to come forward and lift their anonymity through the HFEA. Or the donor (and donor conceived person) can place themselves on the <a href="https://www.liverpoolwomens.nhs.uk/our-services/donor-conceived-register-dcr/">Donor Conceived Register</a> (DCR), set up to match pre-1991 donor parents and children and siblings sharing the same donor. </p>
<h2>Do it yourself DNA</h2>
<p>At least this was the case until an explosion in at-home DNA test kits being sold to the public by direct to consumer (DTC) testing companies such as Ancestry, 23andMe, MyHeritage. They can be bought online for as little as £50. It is thought that over <a href="https://www.advisory.com/daily-briefing/2020/02/20/dna-tests">30 million people</a> worldwide have bought these test kits. </p>
<p>This third route to tracing your biological family is one I am well acquainted with as the lead genetic genealogist on <a href="https://www.bbc.co.uk/programmes/m000sthc">BBC 2’s DNA Family Secrets</a> hosted by Stacey Dooley. Genetic testing companies have enormous databases that make it increasingly easy to find your donor. </p>
<p>You can simply take a DNA test and look for people that match your DNA. If you can’t fit these matches into your known family tree, then it could be because they’re from your donor’s family. Sometimes people get matches with a donor-sibling or their donor immediately.</p>
<figure class="align-center ">
<img alt="Little colourful balloons with ribbon" src="https://images.theconversation.com/files/475102/original/file-20220720-9535-asrswp.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/475102/original/file-20220720-9535-asrswp.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=410&fit=crop&dpr=1 600w, https://images.theconversation.com/files/475102/original/file-20220720-9535-asrswp.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=410&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/475102/original/file-20220720-9535-asrswp.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=410&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/475102/original/file-20220720-9535-asrswp.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=515&fit=crop&dpr=1 754w, https://images.theconversation.com/files/475102/original/file-20220720-9535-asrswp.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=515&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/475102/original/file-20220720-9535-asrswp.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=515&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Many men donated sperm and assumed they could not be traced.</span>
<span class="attribution"><a class="source" href="https://www.shutterstock.com/image-photo/colorful-balloons-spermatozoid-shape-on-blue-1100465771">olliulli/Shutterstock</a></span>
</figcaption>
</figure>
<p>The first such case to make headlines was in 2005 when a 15-year-old boy bought a Y chromosome test in the hope of <a href="http://news.bbc.co.uk/1/hi/health/4400778.stm">finding his father</a>. The Y chromosome is a segment of DNA passed down through the male line, from father to son, much as a surname often is. </p>
<p>The lad’s Y chromosome test brought up matches with two men that must have been related to his sperm donor father. They also had spelling variants of the same surname. Armed with his father’s date and place of birth, university degree and a potential surname, he turned to private investigator company Omnitrace. Within hours he traced his supposedly anonymous sperm donor father. </p>
<p>Since then, genetic testing has become more advanced. You can even hire a genetic genealogist to do the work for you, although success is not guaranteed. The floodgates are well and truly open.</p>
<h2>Family secrets</h2>
<p>In the second series of <a href="https://www.bbc.co.uk/programmes/m000sthc">DNA Family Secrets</a>, which aired in 2022, 46-year-old Mel came to us wondering if she could find out who her sperm donor father was. Testing with a couple of the big direct to consumer companies revealed two relatively close matches. It took literally minutes to work out that her donor father was one of three brothers. DNA testing one of their sons joined the dots. </p>
<p>On the other side of the coin is 53-year-old Luke, who after the death of a close friend, began to think about the consequences of donating his sperm in the 80s and 90s. He knew from the HFEA he had at least six children but had no idea who they were. He came to DNA Family Secrets to lift his anonymity further. He not only put himself on the DCR but also took DNA tests. At the time of broadcast, no further people were found but they may well come forward in the future.</p>
<p>Luke is rare. Just over 200 men, out of the many thousands of men who have donated sperm over the years, have lifted their anonymity prior to donor anonymity rules changing.</p>
<p>Some men donate sperm for the compensation payments (<a href="https://www.londonspermbank.com/blog/how-much-do-uk-sperm-banks-compensate-their-donors/">set at £35 in the UK</a>), others for altruistic reasons to help infertile couples. </p>
<p>Other men have contacted me to share their stories. They donated sperm years ago and have been found after they or a relative took a DNA test with one of the big companies. Some have never told their partners or children that they donated. The emotional reverberations for their families can be enormous. Both Mel and Luke benefited from the behind-the-scenes support of the social workers and counsellors that we provide as part of the programme. Others do not. </p>
<p>The HFEA are <a href="https://www.theguardian.com/society/2022/may/20/uk-fertility-watchdog-could-recommend-scrapping-donor-anonymity-law">considering lifting donor anonymity</a> retrospectively. Any change in the law would be up to parliament to decide. The Australian government did so with <a href="https://aifs.gov.au/publications/family-matters/issue-98/donor-identification">Narelle’s law</a> named in memory a woman died from bowel cancer inherited from her donor father. </p>
<p>Next year could bring some extraordinary reunions. The time is now to discuss how society handles, and supports, those born before 2005.</p><img src="https://counter.theconversation.com/content/183191/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Turi King does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>Taking a DNA test kit sounds like harmless fun but some people end up getting more than they bargained for.Turi King, Professor of Genetics and Public Engagement, University of LeicesterLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1788662022-06-03T12:20:19Z2022-06-03T12:20:19ZGenetic paparazzi are right around the corner, and courts aren’t ready to confront the legal quagmire of DNA theft<figure><img src="https://images.theconversation.com/files/466687/original/file-20220601-48041-5tdwjf.jpg?ixlib=rb-1.1.0&rect=0%2C0%2C2309%2C1299&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">DNA is a trove of personal information that can be hard to keep track of and protect. </span> <span class="attribution"><a class="source" href="https://www.gettyimages.com/detail/photo/dna-royalty-free-image/1369527112">Boris Zhitkov/Moment via Getty Images</a></span></figcaption></figure><p>Every so often stories of <a href="https://ssrn.com/abstract=1684337">genetic theft</a>, or extreme precautions taken to avoid it, make headline news. So it was with a <a href="https://www.theweek.in/news/world/2022/02/12/explained-what-is-dna-theft-why-did-macron-refuse-russian-covid-test.html">picture</a> of French President Emmanuel Macron and Russian President Vladimir Putin sitting at <a href="https://www.reuters.com/world/europe/putin-kept-macron-distance-snubbing-covid-demands-sources-2022-02-10/">opposite ends of a very long table</a> after Macron declined to take a Russian PCR COVID-19 test in 2022. Many <a href="https://www.firstpost.com/world/dna-theft-fears-why-french-and-german-leaders-refused-to-take-russian-covid-test-10386501.html">speculated</a> that Macron refused due to security concerns that the Russians would take and use his DNA for nefarious purposes. German Chancellor Olaf Scholz <a href="https://www.theweek.co.uk/news/world-news/russia/955813/why-world-leaders-refuse-give-russia-dna">similarly refused</a> to take a Russian PCR COVID-19 test.</p>
<p>While these concerns may seem relatively new, pop star celebrity Madonna has been raising alarm bells about the potential for nonconsensual, surreptitious collection and testing of DNA for over a decade. She has <a href="https://geneticliteracyproject.org/2016/02/19/madonna-may-suffer-dna-paranoia/">hired cleaning crews</a> to sterilize her dressing rooms after concerts and requires her own new toilet seats at each stop of her tours. </p>
<p>At first, Madonna was ridiculed for having <a href="https://www.dailymail.co.uk/tvshowbiz/article-2163460/Paranoia-Madonna-orders-sterile-sweep-dressing-room-gig-prevent-fans-stealing-DNA.html">DNA paranoia</a>. But as more advanced, faster and cheaper genetic technologies have reached the consumer realm, these concerns seem not only reasonable, but justified.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/466685/original/file-20220601-66680-bioj3t.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="Putin and Macron sitting at opposite ends of a long table" src="https://images.theconversation.com/files/466685/original/file-20220601-66680-bioj3t.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/466685/original/file-20220601-66680-bioj3t.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=380&fit=crop&dpr=1 600w, https://images.theconversation.com/files/466685/original/file-20220601-66680-bioj3t.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=380&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/466685/original/file-20220601-66680-bioj3t.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=380&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/466685/original/file-20220601-66680-bioj3t.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=478&fit=crop&dpr=1 754w, https://images.theconversation.com/files/466685/original/file-20220601-66680-bioj3t.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=478&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/466685/original/file-20220601-66680-bioj3t.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=478&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">For some, keeping one’s distance might be a preferable alternative to getting one’s DNA stolen.</span>
<span class="attribution"><a class="source" href="https://newsroom.ap.org/detail/RussiaUkraineTalkingtoPutin/0778415f155a4cff94894c58f9fb6bb8">AP Photo/Pool Sputnik Kremlin</a></span>
</figcaption>
</figure>
<p><a href="https://law.emory.edu/faculty/faculty-profiles/vertinsky-profile.html">We are</a> <a href="https://scholar.google.com/citations?user=OKxLE-QAAAAJ&hl=en">law professors</a> who study how emerging technologies like genetic sequencing are regulated. We <a href="https://papers.ssrn.com/sol3/papers.cfm?abstract_id=3559405">believe that</a> growing public interest in genetics has increased the likelihood that <a href="https://www.cambridge.org/core/books/abs/consumer-genetic-technologies/genetic-paparazzi/7B0D35C61C3CBD9DA3FE0D457C22BB9B">genetic paparazzi</a> with DNA collection kits may soon become as ubiquitous as ones with cameras. </p>
<p>While courts have for the most part <a href="https://www.forbes.com/sites/michellefabio/2018/04/23/madonna-loses-fight-to-reclaim-tupacs-letter-other-highly-personal-items/">managed to evade</a> dealing with the complexities of surreptitious DNA collection and testing of public figures, they won’t be able to avoid dealing with it for much longer. And when they do, they are going to run squarely into the <a href="https://papers.ssrn.com/sol3/papers.cfm?abstract_id=3559405">limitations of existing legal frameworks</a> when it comes to genetics.</p>
<h2>Genetic information troves</h2>
<p>You <a href="https://journalofethics.ama-assn.org/article/shedding-privacy-along-our-genetic-material-what-constitutes-adequate-legal-protection-against/2016-03">leave your DNA behind you</a> everywhere you go. The strands of hair, fingernails, dead skin and saliva you shed as you move through your day are all collectible trails of DNA.</p>
<p>Genetic analysis can reveal not only personal information, such as existing health conditions or risk for developing certain diseases, but also core aspects of a person’s identity, such as their ancestry and the potential traits of their future children. In addition, as genetic technologies continue to evolve, fears about using surreptitiously collected genetic material for <a href="https://news.gsu.edu/2020/04/28/genetic-paparazzi-could-celebrity-dna-become-public-domain/">reproductive purposes</a> via <a href="https://doi.org/10.1093/jlb/lsv057">in vitro gametogenesis</a> become more than just paranoia.</p>
<figure>
<iframe width="440" height="260" src="https://www.youtube.com/embed/Eb_o8hQNUFI?wmode=transparent&start=0" frameborder="0" allowfullscreen=""></iframe>
<figcaption><span class="caption">In vitro gametogenesis (IVG), while still in development, could allow prospective parents to create egg or sperm from other parts of the body, like skin.</span></figcaption>
</figure>
<p>Ultimately, taking an individual’s genetic material and information without their consent is an intrusion into a legal domain that is still considered <a href="https://doi.org/10.1017/9781108874106.012">deeply personal</a>. Despite this, there are <a href="https://papers.ssrn.com/sol3/papers.cfm?abstract_id=3559405">few laws</a> protecting the interests of individuals regarding their genetic material and information. </p>
<h2>Existing legal frameworks</h2>
<p>When disputes involving genetic theft from public figures inevitably reach the courtroom, judges will need to confront fundamental questions about how genetics relates to personhood and identity, property, health and disease, intellectual property and reproductive rights. Such questions have already been raised in cases involving the <a href="https://www.virginialawreview.org/articles/genetic-privacy-after-carpenter/">use of genetics in law enforcement</a>, the <a href="https://www.science.org/content/article/us-supreme-court-strikes-down-human-gene-patents">patentability of DNA</a> and ownership of <a href="https://scholarship.law.nd.edu/ndlr/vol93/iss3/5/">discarded genetic materials</a>. </p>
<p>In each of these cases, courts focused on <a href="https://columbialawreview.org/content/dna-by-the-entirety-2/">only one dimension</a> of genetics, such as privacy rights or the value of genetic information for biomedical research. But this limited approach disregards <a href="https://doi.org/10.1111/j.1748-720x.2007.00161.x">other aspects</a>, such as the privacy of family members with shared genetics, or property and identity interests someone may have in genetic material discarded as part of a medical procedure.</p>
<p><div data-react-class="Tweet" data-react-props="{"tweetId":"1336309197697413123"}"></div></p>
<p>In the case of genetic paparazzi, courts will presumably try to fit complex questions about genetics into the legal framework of <a href="https://scholarship.law.upenn.edu/jcl/vol19/iss4/4/">privacy rights</a> because this is how they have approached other intrusions into the lives of public figures in the past. </p>
<p>Modern <a href="https://heinonline.org/HOL/LandingPage?handle=hein.journals/hclwpo11&div=16&id=&page=">U.S. privacy law</a> is a complex web of state and federal regulations governing how information can be acquired, accessed, stored and used. The right to privacy is limited by First Amendment protections on the freedom of speech and press, as well as Fourth Amendment prohibitions on unreasonable searches and seizure. <a href="https://scholarship.law.upenn.edu/cgi/viewcontent.cgi?article=1633&context=jcl">Public figures</a> face further restrictions on their privacy rights because they are objects of legitimate public interest. On the other hand, they also have publicity rights that control the commercial value of their unique personally identifying traits.</p>
<p>People whose genetic material has been taken without their consent may also raise a <a href="https://papers.ssrn.com/sol3/papers.cfm?abstract_id=3357566">claim of conversion</a> that their property has been interfered with and lost. Courts in Florida are currently considering a conversion claim in a <a href="https://gizmodo.com/how-a-legal-brawl-between-two-rich-guys-could-change-ho-1824191082">private dispute</a> where the former CEO of Marvel Entertainment and his wife accused a millionaire businessman of stealing their DNA to prove that they were slandering him through a hate-mail campaign. This approach replaces the narrow legal framework of privacy with an even narrower framework of property, reducing genetics to an object that someone possesses.</p>
<h2>What the future may hold</h2>
<p>Under existing laws and the current state of genetic technology, most people don’t need to worry about surreptitious collection and use of genetic material in the way that public figures might. But genetic paparazzi cases will likely play an important role in determining what rights everyone else will or will not have.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/466689/original/file-20220601-48776-susuv1.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="Open 23andMe genetic testing kit" src="https://images.theconversation.com/files/466689/original/file-20220601-48776-susuv1.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/466689/original/file-20220601-48776-susuv1.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/466689/original/file-20220601-48776-susuv1.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/466689/original/file-20220601-48776-susuv1.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/466689/original/file-20220601-48776-susuv1.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/466689/original/file-20220601-48776-susuv1.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/466689/original/file-20220601-48776-susuv1.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">As DNA testing technology advances, questions about genetic privacy and ownership will only become more complex.</span>
<span class="attribution"><a class="source" href="https://www.gettyimages.com/detail/news-photo/this-illustration-picture-shows-a-saliva-collection-kit-for-news-photo/1074407824">Eric Baradat/AFP via Getty Images</a></span>
</figcaption>
</figure>
<p>The U.S. Supreme Court is very unlikely to recognize new rights, or even affirm previously recognized rights, that are <a href="https://www.washingtonpost.com/outlook/2022/03/25/ketanji-brown-jackson-roe/">not explicitly mentioned in the Constitution</a>. Therefore, at least at the federal level, individual protections for genetic material and information are not likely to adapt to changing times.</p>
<p>This means that cases involving genetics are likely to fall within the purview of state legislatures and courts. But none of the states have <a href="https://papers.ssrn.com/sol3/papers.cfm?abstract_id=3559405">adequately grappled</a> with the complexities of genetic legal claims. Even in states with laws specifically designed to protect genetic privacy, regulations cover only a <a href="https://doi.org/10.1038/nrg3113">narrow range</a> of genetic interests. Some laws, for example, may prohibit disclosure of genetic information, but not collection.</p>
<p>For better or for worse, how the courts rule in genetic paparazzi cases will shape how society thinks about genetic privacy and about individual rights regarding genetics more broadly.</p><img src="https://counter.theconversation.com/content/178866/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>The authors do not work for, consult, own shares in or receive funding from any company or organization that would benefit from this article, and have disclosed no relevant affiliations beyond their academic appointment.</span></em></p>Both Macron and Madonna have expressed concerns about genetic privacy. As DNA collection and sequencing becomes increasingly commonplace, what may seem paranoid may instead be prescient.Liza Vertinsky, Professor of Law, University of MarylandYaniv Heled, Professor of Law, Georgia State UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1669402022-04-19T12:20:59Z2022-04-19T12:20:59ZHow a South African community’s request for its genetic data raises questions about ethical and equitable research<figure><img src="https://images.theconversation.com/files/447331/original/file-20220218-43570-jbyp9t.jpg?ixlib=rb-1.1.0&rect=0%2C0%2C2941%2C1959&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">Many researchers are interested in the genetic history of the Khoe-San.</span> <span class="attribution"><span class="source">Dana Al-Hindi</span>, <a class="license" href="http://creativecommons.org/licenses/by-nc-nd/4.0/">CC BY-NC-ND</a></span></figcaption></figure><p>Scientists believe Africa is where <a href="https://www.pbs.org/newshour/science/cradle-of-modern-human-life-found-in-botswana-maybe">modern humans first emerged</a>. For the past decade, our team of <a href="https://scholar.google.com/citations?user=sDUNh9UAAAAJ&hl=en">genetic</a> <a href="http://hennlab.ucdavis.edu/dana-al-hindi.html">researchers</a> from the <a href="http://hennlab.ucdavis.edu/">Henn Lab</a> have worked among the Khoe-San and self-identified “<a href="https://www.semanticscholar.org/paper/What%27s-in-a-name-Racial-categorisations-under-and-Posel/81e1ad38d1f37b37fe1cddd8a81081b378242217">Coloured</a>” communities in South Africa, which comprise multiple ethnic groups in the region, requesting DNA and generating genetic data to help unravel the history and prehistory of southern Africans and their relationship to populations around the world. </p>
<p>While we have learned a great deal from these communities, we have been unable to fulfill a common request: providing them their individual genetic ancestry results. In our attempts to overcome the logistical challenges of providing this information, we’ve grappled with the common question of how to ensure an equitable balance of benefits between researchers and the community they study. What we’ve found is that there is no easy answer. </p>
<h2>The history of the Khoe-San</h2>
<p>Community member requests to see their genetic results came as no surprise. Many South African groups were stripped of their identities and collapsed into one overarching racial category known as “<a href="https://doi.org/10.1016/S1090-9524(03)00007-X">Coloured</a>” during the early 1900s. Early <a href="https://muse.jhu.edu/book/35209">European colonizers</a> initially used this term to refer to indigenous Khoekhoe and San groups long before it was codified by the apartheid government in 1948. It persists today as an ethnic category, broadly encompassing Khoe-San groups, various East African, Indian and Southeast Asian populations brought by the slave trade, and people of mixed ancestry. </p>
<p><a href="https://doi.org/10.1534/genetics.116.187369">We</a> and <a href="https://doi.org/10.1126/science.1227721">other</a> research groups have shown that some Coloured communities are largely descendants of the Khoe and San peoples. Other ancestries present in Coloured communities are from Bantu-speaking populations that migrated into the region from <a href="https://doi.org/10.1093/hmg/ddaa274">western Africa</a> around 1,500 years ago and from <a href="https://doi.org/10.1186/s12915-020-0746-1">Europe</a> a little under 400 years ago. <a href="https://doi.org/10.1186/s12915-020-0746-1">Asian ancestry</a> is also present as a result of the aforementioned slave trade.</p>
<p>The Khoe and San are considered the most <a href="https://doi.org/10.1073/pnas.1017511108">genetically diverse</a> human populations currently known, meaning they have a large amount of genetic differences within and between each community. Though they are distinct groups, they share genetic similarities with each other. As a result, geneticists collectively refer to them as <a href="https://doi.org/10.1038/464487a">Khoe-San</a>, using a hyphen to acknowledge their cultural distinction.</p>
<p>Today, few people identify as Khoe or San in South Africa. Rather, many people call themselves Coloured, though they are deeply aware of the term’s racist legacy. </p>
<h2>Logistical challenges and potential risks</h2>
<p>In our 12 years of fieldwork, we have returned to South Africa on a nearly annual basis to update community-level genetic results. At each visit, most of our participants ask about their personal genetic ancestry results. </p>
<p>But there are several hurdles we face in trying to fulfill their requests. For one, we need to be able to translate scientifically complex data into an accessible and digestible form, a skill that researchers are not always equipped with. Additionally, we must work within restrictions set by <a href="http://www.sun.ac.za/english/faculty/healthsciences/rdsd/Documents/Ethics/DoH%202015%20Ethics%20in%20Health%20Research%20-%20Principles,%20Processes%20and%20Structures%202nd%20Ed.pdf">the local government</a>, which is mediated by the Health Research Ethics Committee at our collaborators’ academic institution, as well as restrictions set by the <a href="http://trust-project.eu/wp-content/uploads/2017/03/San-Code-of-RESEARCH-Ethics-Booklet-final.pdf">South African San Council</a>.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/449876/original/file-20220303-4451-15ykg4f.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="Enrolled research participant holding the spitkit during saliva collection" src="https://images.theconversation.com/files/449876/original/file-20220303-4451-15ykg4f.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/449876/original/file-20220303-4451-15ykg4f.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=612&fit=crop&dpr=1 600w, https://images.theconversation.com/files/449876/original/file-20220303-4451-15ykg4f.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=612&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/449876/original/file-20220303-4451-15ykg4f.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=612&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/449876/original/file-20220303-4451-15ykg4f.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=770&fit=crop&dpr=1 754w, https://images.theconversation.com/files/449876/original/file-20220303-4451-15ykg4f.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=770&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/449876/original/file-20220303-4451-15ykg4f.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=770&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Researchers extracted DNA from saliva samples.</span>
<span class="attribution"><span class="source">Dana Al-Hindi</span>, <a class="license" href="http://creativecommons.org/licenses/by-nc-nd/4.0/">CC BY-NC-ND</a></span>
</figcaption>
</figure>
<p>There are also <a href="https://www.ncbi.nlm.nih.gov/books/NBK525077/">potential risks</a> to the participant. Group-level results provide a protective blanket from potential legal or social issues that can arise from individual ancestry results. For example, a participant may learn that their biological father is not who they believed they were, which could sow conflict in the family and unease for the participant. More generally, the participant faces the social risk of being included or excluded from different communities depending on the outcome of the results.</p>
<p>We discussed these potential problems with past participants and found that most community members care little about the risks. Our participants have consistently viewed the option to receive their personal ancestry results as a benefit of taking part in research. They simply want to know who their forefathers were.</p>
<h2>Helicopter research and exploitation</h2>
<p>To fulfill these requests, we’ve partnered with <a href="https://www.23andme.com/">23andMe Inc.</a>, a U.S.-based company that provides at-home genetic testing. One of us previously worked for 23andMe on its ancestry team and continues to maintain a relationship with scientists at the company. When 23andMe launched a <a href="https://blog.23andme.com/23andme-research/23andmes-populations-collaborations/">program in 2018</a> to improve genetic data on underrepresented communities in biomedical and genetic research, we were excited to see an emphasis on local partnerships and community grants. We submitted a successful application, and 23andMe has provided us with funding to conduct this research.</p>
<p>As academic researchers, we don’t always have the right expertise on how to best communicate personal results. Nor do we often have the funds to successfully execute this task. Research grants do not typically provide support for community development, and graduate and postdoctoral researchers lack protected time to do this on top of their other responsibilities. 23andMe, on the other hand, already has the resources and the experience to accessibly communicate personal genomic results to lay people, because that’s its commercial product. Thus, collaborations with for-profit organizations is not uncommon. Along with <a href="https://doi.org/10.1101/2022.02.07.478793">23andMe</a>, academic researchers have also worked with genetic testing companies <a href="https://www.forbes.com/sites/tommywilliams1/2020/02/29/meet-54gene-changing-the-landscape-of-global-dna-by-including-africa/?sh=6a92cbc55abd">54gene</a> and <a href="https://medium.com/variantbio/variant-bio-launches-new-partnership-on-kidney-disease-in-south-africa-ef3657fb4f3d">Variant Bio</a>.</p>
<p>With approval from the research ethics committee of the local university we work with, 23andMe will fund the expenses of our fieldwork and a community grant, in addition to processing our DNA samples in exchange for data access. They plan to use the data to improve African ancestry results for their customers and for their own research projects. </p>
<p>The company made <a href="https://www.bloomberg.com/news/features/2021-11-04/23andme-to-use-dna-tests-to-make-cancer-drugs">over US$50 million</a> in 2021, and its plans to use the genetic data it has accumulated from its customers to develop pharmaceuticals has not been without <a href="https://www.nytimes.com/2021/09/20/opinion/23andme-dna.html">controversy</a> in the U.S. The samples collected in our partnership with 23andMe, however, would not be used to develop new drugs. While our research focuses primarily on broadening scientific knowledge, and 23andMe does make an effort to follow an <a href="https://blog.23andme.com/23andme-research/an-ethical-framework-for-international-research/">ethical framework</a> for collaborations like these, our developing partnership has heightened our concerns about exploitation and what’s known as <a href="https://doi.org/10.1038/d41586-021-01795-1">helicopter research</a>.</p>
<p>Scientists conduct helicopter research when they collect data from developing countries and marginalized communities with little to no involvement from local researchers and community members. Helicopter research also occurs when researchers take data out of the country they collected it from without either providing benefit to or sharing the results with the community.</p>
<figure>
<iframe width="440" height="260" src="https://www.youtube.com/embed/HOBlWaH-Owo?wmode=transparent&start=0" frameborder="0" allowfullscreen=""></iframe>
<figcaption><span class="caption">Informed consent is not enough to prevent research from being exploitative.</span></figcaption>
</figure>
<p>San communities are <a href="https://www.smithsonianmag.com/smart-news/san-people-south-africa-issue-code-ethics-researchers-180962615/">no strangers</a> to helicopter research. For example, <a href="https://doi.org/10.1007/978-90-481-3123-5_6">hoodia</a> is a cactus San communities use to suppress appetite during long hunts or famine. Pharmaceutical companies researched and patented this cultural knowledge in 1995 to develop and sell an anti-obesity pill, initially all without San recognition or involvement. If the San were acknowledged at all, they were referred to as a <a href="https://uwapress.uw.edu/book/9780295742175/reinventing-hoodia/">population that no longer existed</a>. After several legal disputes, the San were promised benefits from any production that came out of the project. Though they received <a href="https://www.unl.edu/rhames/courses/current/hoodia.htm">some compensation</a>, it was a fraction of the value they funneled toward the research and <a href="https://uwapress.uw.edu/book/9780295742175/reinventing-hoodia/">nowhere near what was promised</a>.</p>
<p>This has been a recurring issue for the Khoe and San communities, most recently involving the <a href="https://doi.org/10.1038/d41586-019-03374-x">rooibos tea industry</a>. Companies conducted over a century of commercial rooibos farming benefiting from Khoe and San cultural knowledge before finally agreeing to pay 1.5% of what farmers make for unprocessed rooibos to the communities. Because of this, gaining approval from the local university’s ethics committee for our project has been difficult, and understandably so.</p>
<p>To build a more active and transparent relationship with the local community, we are working closely with 23andMe to develop an advisory board of members from local communities. We have held town halls and conducted interviews with locals to ask if they’d still be interested in being a part of this research project if a company became involved. The majority expressed little concern about 23andMe’s involvement and potentially profiting from their genetic information. But history has shown that for study participants around the globe, <a href="https://doi.org/10.1017/S0963180111000259">informed consent</a> has its limitations. It is still difficult to communicate and gauge whether participants, or the <a href="https://www.vox.com/recode/2019/12/13/20978024/genetic-testing-dna-consequences-23andme-ancestry">millions of Americans</a> who have paid 23andMe for genetic testing, fully understand the full extent of the risks involved with giving away their genetic data, both to 23andMe and to us academic researchers.</p>
<p>The company has offered to provide small community grants to help meet local needs, and has also expanded our ability to “<a href="https://www.un.org/en/academic-impact/capacity-building">capacity-build</a>” – that is, to make sure that the knowledge and skills we gain are shared with local institutions. But the question remains whether there is an equitable balance of benefits. Other companies have already promised <a href="https://54gene.com/we-have-launched-a-trust-to-reinvest-5-of-proceeds-from-commercial-drug-discovery-programs-on-african-scientists-and-communities/">long-term benefits</a> by <a href="https://www.variantbio.com/faq">sharing equity and profit</a> with participating communities. Are individual ancestry results and community grants a sufficient and fair exchange against the profits the company will gain from this collaboration?</p>
<h2>Where does this leave us?</h2>
<p>Academic researchers are faced with navigating the many trade-offs that come with industry collaborations. While 23andMe’s participation provides a means to return individual results to the community, it also raises questions about sufficiently equitable benefits. Our research team, local collaborators and 23andMe are all concerned about how to best address the risk of helicopter research, coercion and any unknown risks that may arise from disclosing personal ancestry results. </p>
<p>In an ideal world, researchers would be able to return benefits to the community without involving nonacademic external parties. Integrating practices like returning results to communities within <a href="https://doi.org/10.1371/journal.pcbi.1009277">research grant requirements</a> is one way to ensure that participants are also benefiting from research. Nonprofit small grants dedicated to returning results and community benefit are another. Until then, researchers will continue to make do with the limited resources they have.</p>
<p><em>This article was updated to more accurately reflect how 23andMe will use the collected data.</em></p><img src="https://counter.theconversation.com/content/166940/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Dana Al-Hindi intends to use Dr. Henn's awarded funds from 23andMe Inc. to complete fieldwork and return of results to sampled communities. </span></em></p><p class="fine-print"><em><span>Brenna Henn is a former employee of 23andMe, Inc. and retains shares in the organization. She has received funding from 23andMe to complete research described in this article. </span></em></p>The South African Khoe-San communities are no strangers to exploitative research. One research team is trying to provide genetic ancestry results to community members. But they still face many challenges.Dana Al-Hindi, PhD Candidate in Anthropology, University of California, DavisBrenna Henn, Associate Professor of Anthropology, University of California, DavisLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1743892022-01-18T13:40:25Z2022-01-18T13:40:25ZSperm donation is largely unregulated, but that could soon change as lawsuits multiply<figure><img src="https://images.theconversation.com/files/440766/original/file-20220113-19-14yu4a4.jpg?ixlib=rb-1.1.0&rect=101%2C14%2C1895%2C1302&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">Freezing and storing sperm vials has proved easier than regulating artificial insemination.</span> <span class="attribution"><a class="source" href="https://www.gettyimages.com/detail/news-photo/lab-technician-jessica-kenyon-puts-sperm-vials-into-liquid-news-photo/1290396268">MediaNews Group/Boston Herald via Getty Images</a></span></figcaption></figure><p>When Wendy and Janet Norman decided to have a baby, they went sperm shopping through Xytex Corp., a <a href="https://www.mayoclinic.org/tests-procedures/sperm-donation/about/pac-20395032">sperm bank</a>.</p>
<p>The couple chose Donor #9623. Xytex, the Normans later claimed, told them the man <a href="https://www.gpb.org/news/2020/09/28/georgia-supreme-court-rules-sperm-donor-case-falls-in-line-consumer-fraud">spoke multiple languages</a> and was <a href="https://www.gasupreme.us/wp-content/uploads/2020/09/s19g1486.pdf">pursuing a doctorate</a>.</p>
<p>Xytex had also assured them that it carefully screened all donors by reviewing their family health history and criminal records and that it subjected donors to intensive physical exams and interviews to <a href="https://www.gasupreme.us/wp-content/uploads/2020/09/s19g1486.pdf">verify the information</a>.</p>
<p>But after Wendy Norman gave birth to a son in 2002, the couple learned their child had inherited a genetic blood disorder for which Wendy was not a carrier. He would, much later, require extended hospitalizations because of suicidal and homicidal thoughts.</p>
<p>Even later, they learned that the donor, James Christopher Aggeles, had <a href="https://scholar.google.com/scholar_case?case=2684447592603399491&hl=en&as_sdt=6&as_vis=1&oi=scholarr">lied to the sperm bank</a> about his background and that the sperm bank had not verified the information he provided. Nor did it make him supply his medical records or sign a release that would have made it possible to obtain them.</p>
<p>As <a href="https://www.law.virginia.edu/faculty/profile/nrc8g/2915359">law professors</a> who study <a href="https://www.law.gwu.edu/sonia-m-suter">reproductive technology</a>, we see this case and others like it as showing why the government should tighten regulations over sperm and egg donation so that prospective parents and <a href="https://doi.org/10.1093/hropen/hoaa057">donor-conceived adults</a> receive accurate and complete details about their donors’ medical, academic and criminal history. </p>
<h2>A ‘wrongful birth’?</h2>
<p>Aggeles wasn’t pursuing an advanced degree when he began donating sperm. He didn’t even have a college degree at that point. He also failed to disclose his diagnosis of <a href="https://www.mayoclinic.org/diseases-conditions/schizophrenia/diagnosis-treatment/drc-20354449">schizophrenia</a>, a severe mental health condition requiring lifelong treatment. Schizophrenia has a <a href="https://www.healthline.com/health/is-schizophrenia-hereditary">high level of heritability</a> in families. He had also been arrested at the time of his donation and was later <a href="https://scholar.google.com/scholar_case?case=2684447592603399491&hl=en&as_sdt=20000006&as_vis=1">incarcerated for burglary</a>.</p>
<p>When the Normans sued Xytex, a local court initially dismissed <a href="https://scholar.google.com/scholar_case?case=2684447592603399491&hl=en&as_sdt=6&as_vis=1&oi=scholarr">almost all claims in</a> their case. They appealed to Georgia’s Supreme Court, which in 2020 <a href="https://www.gasupreme.us/wp-content/uploads/2020/09/s19g1486.pdf">allowed several of their claims to go forward</a>. </p>
<p>The Normans could, for instance, seek financial compensation, partly to cover the additional expenses they might have avoided had they learned about the donor’s medical history sooner. The court also told the Normans they could try to recover the price difference between what they paid for the sperm they received and <a href="https://www.nytimes.com/2021/01/08/business/sperm-donors-facebook-groups.html">its market value</a>.</p>
<p>Finally, the Normans were allowed to allege under the state’s <a href="https://law.justia.com/codes/georgia/2010/title-10/chapter-1/article-15/part-2/">Fair Business Practice Act</a> that the sperm bank had misrepresented to the public the quality of its sperm and its screening process.</p>
<p>The Supreme Court of Georgia did not, however, permit the couple to sue over what is known as a “<a href="https://lawdigitalcommons.bc.edu/jlsj/vol34/iss2/8/">wrongful birth</a>” claim. These claims are negligence actions brought by parents based on the birth of a child with disabilities or genetic disorders because of a provider’s failure to identify the risk.</p>
<p>The case is still pending.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/440478/original/file-20220112-25-14gowjp.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="Blue-tinted sperm swim in a liquid." src="https://images.theconversation.com/files/440478/original/file-20220112-25-14gowjp.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/440478/original/file-20220112-25-14gowjp.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=450&fit=crop&dpr=1 600w, https://images.theconversation.com/files/440478/original/file-20220112-25-14gowjp.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=450&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/440478/original/file-20220112-25-14gowjp.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=450&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/440478/original/file-20220112-25-14gowjp.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=566&fit=crop&dpr=1 754w, https://images.theconversation.com/files/440478/original/file-20220112-25-14gowjp.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=566&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/440478/original/file-20220112-25-14gowjp.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=566&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Screening sperm donors is often limited to seeing if they have communicable diseases.</span>
<span class="attribution"><a class="source" href="https://www.gettyimages.com/detail/illustration/human-sperm-royalty-free-illustration/674416385">Sebastian Kaulitzki/Science Photo Library</a></span>
</figcaption>
</figure>
<h2>Limited regulation</h2>
<p>The Normans’ lawsuit is hardly unique.</p>
<p>Other families have <a href="https://www.nytimes.com/2012/05/15/health/in-sperm-banks-a-matrix-of-untested-genetic-diseases.html">sued sperm banks</a> after having donor-conceived children who wound up with a variety of <a href="https://www.riverfronttimes.com/newsblog/2019/02/08/st-louis-dad-sues-sperm-bank-after-baby-is-born-with-genetic-disorder">genetic disorders</a>.</p>
<p>In many of those cases, the sperm banks said they routinely test sperm and exclude donors who could pass along genes that cause genetic diseases. In those instances, the families have grounds for accusing the sperm banks of fraud and negligence.</p>
<p>Some <a href="https://apnews.com/article/lifestyle-technology-health-new-york-lawsuits-3c4280eb72f05f9b5f33238b0b608da6">donor-conceived adults</a> are also <a href="https://www.voiceofsandiego.org/topics/news/dna-testing-is-unearthing-local-fertility-fraud-cases/">suing doctors</a> who lied to the plaintiffs’ parents about <a href="https://apnews.com/article/a86db8b20d5a36213dfbb169a5a031fe">whose sperm</a> they were receiving and instead <a href="https://apnews.com/article/lifestyle-technology-health-new-york-lawsuits-3c4280eb72f05f9b5f33238b0b608da6">used their own</a>. Several states now ban this kind of “<a href="https://khn.org/news/conceived-through-fertility-fraud-she-now-needs-fertility-treatment/">fertility fraud</a>.” </p>
<p>This <a href="https://www.wsj.com/articles/a-grieving-family-wonders-what-if-they-had-known-the-medical-history-of-sperm-donor-1558-11641119405">litigation is on the rise</a> because of the growing popularity of direct-to-consumer DNA testing, which makes it <a href="https://www.cbsnews.com/news/woman-finds-sperm-donor-after-using-dna-test-raising-questions-about-donor-anonymity/">easier to identify previously anonymous</a> sperm donors and to learn about genetic risks donor-conceived people may have inherited from them. </p>
<p>It’s also happening because of the <a href="https://www.nytimes.com/2021/02/01/health/sperm-donor-fertility-meijer.html">absence of clear rules and laws regulating</a> sperm banks. There is <a href="https://theconversation.com/the-fertility-industry-is-poorly-regulated-and-would-be-parents-can-lose-out-on-having-children-as-a-result-163792">little regulation of reproductive technologies</a> of any kind, including in <a href="https://theconversation.com/40-years-after-the-birth-of-ivf-researchers-push-boundaries-to-preserve-fertility-in-women-men-and-children-99485">vitro fertilization</a>, a procedure that fertilizes the egg with sperm in the laboratory instead of the body, at the state or federal level.</p>
<p>Because the <a href="https://dx.doi.org/10.1016%2Fj.fertnstert.2019.05.031">government does not track artificial insemination</a>, the number of donor-conceived people is unknown.</p>
<p>The federal government requires only that donated sperm and eggs be treated like other human tissue and <a href="https://www.fda.gov/vaccines-blood-biologics/tissue-tissue-products/donor-eligibility-final-rule-and-guidance-questions-and-answers">tested for communicable diseases</a> – <a href="https://www.dhs.wisconsin.gov/disease/communicable.htm">infectious conditions</a> that spread through viruses, bacteria and other means – but not genetic diseases.</p>
<p>There are also <a href="https://ilr.law.uiowa.edu/print/volume-106-issue-2/dr-i-dont-want-your-baby-why-america-needs-a-fertility-patient-protection-act/">no federal requirements</a> that sperm banks obtain and verify information about a donor’s medical history, educational background or criminal record.</p>
<figure>
<iframe width="440" height="260" src="https://www.youtube.com/embed/yGAktL45XNQ?wmode=transparent&start=0" frameborder="0" allowfullscreen=""></iframe>
<figcaption><span class="caption">The movie ‘Delivery Man’ revolves around what happens when a sperm bank uses a single donor’s sperm to make hundreds of babies.</span></figcaption>
</figure>
<h2>What is the basis for these lawsuits?</h2>
<p>The allowable grounds for fertility negligence vary by state.</p>
<p>Some states let families sue clinics that <a href="https://casetext.com/case/paretta-v-med-offices-for-human-reproduction">fail to screen donors</a>, even when the parents seek damages associated with the birth of the child with a dangerous genetic condition. This would essentially allow a wrongful birth claim to go forward.</p>
<p>But a growing number of states, at least 14 so far, <a href="https://faculty.westacademic.com/Book/Detail?id=320412">prohibit such claims</a>. That is leading many courts, like the Supreme Court of Georgia, to define the injury as distinct from the birth of the donor-conceived child.</p>
<h2>The end of anonymity</h2>
<p>One complication in terms of resolving these disputes is that <a href="https://dx.doi.org/10.1093%2Fjlb%2Flsw052">most sperm donations are anonymous</a>.</p>
<p>At odds with the donor’s interest in keeping their his identity a secret, we argue, are <a href="https://repository.law.umich.edu/mjgl/vol16/iss1/4/">donor-conceived people’s strong interests</a> in learning about their donors, including their medical, educational and criminal history – and <a href="https://scholarlycommons.law.hofstra.edu/hlr/vol42/iss4/3">even identity</a>.</p>
<p>DNA tests, including direct-to-consumer kits like 23andMe, are rendering <a href="https://pubmed.ncbi.nlm.nih.gov/28697325/">donor anonymity impossible to maintain</a>. And internet searches, as the Normans discovered, can make it possible to see whether a donor, once identified, has misrepresented their personal information.</p>
<figure>
<iframe width="440" height="260" src="https://www.youtube.com/embed/RixlpHKfb6M?wmode=transparent&start=0" frameborder="0" allowfullscreen=""></iframe>
<figcaption><span class="caption">The movie ‘The Kids Are All Right’ hinged on the complications that can arise when a family gets to know a sperm donor.</span></figcaption>
</figure>
<h2>States are beginning to set rules</h2>
<p>Because Congress has taken <a href="https://www.cdc.gov/art/nass/policy.html">no action regarding assisted reproductive technology since 1992</a>, states have slowly begun to step in.</p>
<p>In 2011, Washington required the disclosure of <a href="https://app.leg.wa.gov/RCW/default.aspx?cite=26.26A.820">donor-identifying information and medical history when a child turns 18</a>. </p>
<p>On Jan. 1, 2022, Connecticut enacted the <a href="https://www.uniformlaws.org/HigherLogic/System/DownloadDocumentFile.ashx?DocumentFileKey=e4a82c2a-f7cc-b33e-ed68-47ba88c36d92&forceDialog=0">Uniform Parentage Act</a>, which is based on model legislation drafted by a national nonpartisan commission to fill widespread legislative gaps. The measure requires that fertility clinics <a href="https://www.cga.ct.gov/2021/act/pa/pdf/2021PA-00015-R00HB-06321-PA.pdf">collect identifying information from donors</a> and indicate whether donors have agreed to disclosure.</p>
<p>Another pending measure in <a href="https://www.nysenate.gov/legislation/bills/2021/s7602">New York</a> would require sperm and egg donor banks “to collect and verify medical, educational and criminal felony conviction history information” from any donor. That legislation would also provide prospective parents who purchase eggs or sperm and donor-conceived people with the right to obtain such information without personally identifying the donor. This option could make it possible to preserve donor anonymity, at least theoretically.</p>
<p>[<em>Get the best of The Conversation, every weekend.</em> <a href="https://memberservices.theconversation.com/newsletters/?nl=weekly&source=inline-weeklybest">Sign up for our weekly newsletter</a>.]</p>
<p>The bill was drafted at least partially in response to the experience of Laura and David Gunner, <a href="https://www.wsj.com/articles/a-grieving-family-wonders-what-if-they-had-known-the-medical-history-of-sperm-donor-1558-11641119405">whose donor-conceived son died of an opioid overdose</a>. After their son’s death, the Gunners learned that a few years earlier, the donor himself had died and that he had been diagnosed with schizophrenia. The donor had not disclosed his mental illness or hospitalizations for behavioral issues.</p>
<h2>Costs are not a barrier</h2>
<p>It’s possible that measures like the one pending in New York state would make fertility treatment somewhat more expensive.</p>
<p>Currently, a vial of donor sperm may <a href="https://www.marketplace.org/2019/10/24/the-cost-of-building-a-family-using-donor-sperm/">cost close to $1,000</a>, with the <a href="https://www.marketplace.org/2019/10/24/the-cost-of-building-a-family-using-donor-sperm/">donor often being paid up to $150</a>.</p>
<p>Genetic testing, however, might not add much to the cost because it would only be done once, rather than each time a patient obtains a vial of sperm. With artificial insemination, it’s <a href="https://www.verywellfamily.com/donor-insemination-4685684">rare for a pregnancy to occur on the first or second try</a>.</p>
<p>As we learned from <a href="https://www.adoptionnetwork.org/news-events/archive.html/article/2021/03/25/adoption-network-cleveland-supports-fertility-fraud-legislation">Tyler Sniff</a>, an advocate for the New York bill and a director of the nonprofit <a href="https://www.dcc-usa.org/2021/11/14/what-donors-need-to-know/">U.S. Donor Conceived Council</a>, DNA testing companies offer relatively inexpensive options that can cost less than $300. </p>
<p>To be sure, disclosure requirements might overpromise how much <a href="https://www.wsj.com/articles/a-grieving-family-wonders-what-if-they-had-known-the-medical-history-of-sperm-donor-1558-11641119405">prospective parents can learn about their future children</a>. But we are certain that <a href="https://bioethics.umn.edu/news/who-am-i-ethics-sperm-and-egg-donation">these issues will become even more critical</a> as technology continues to outpace its regulation – and as both <a href="https://www.wearedonorconceived.com/">donor-conceived adults</a> and an increasing number of people who used sperm banks advocate for their interests.</p><img src="https://counter.theconversation.com/content/174389/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>The authors do not work for, consult, own shares in or receive funding from any company or organization that would benefit from this article, and have disclosed no relevant affiliations beyond their academic appointment.</span></em></p>Many people are filing lawsuits after discovering that sperm banks failed to verify information from donors about their medical and personal backgrounds.Naomi Cahn, Professor of Law, University of VirginiaSonia Suter, Professor of Law, George Washington UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1713932021-11-18T19:10:19Z2021-11-18T19:10:19ZFriday essay: how do I understand who I am, when my family have hidden themselves from recent history?<p>My auntie has stopped speaking to her siblings. Rifts like these are commonplace in my family, where people fall out with each other like dealt cards. The size of our family doesn’t help. The original eight siblings have grown into four generations and almost 90 people. Full family parties happen only at parks and playgrounds or in the backyards of wealthy family members, which are the only backyards that can accommodate us all.</p>
<p>Some of the grievances are historic, dating back decades and finessed over time. Others are new, fresh. It’s a condition prevalent among migrant families, especially those like mine who have been tentative – because of differences in language, culture, class, education – to socialise widely in Australia. We are tethered to each other and this tether grows thin, frayed by too many gatherings filled with the same faces and the echoes of old pains. In this context my 70-year-old auntie’s antagonism is understandable.</p>
<p>Except for this. She will speak to her siblings (and presumably to us nieces and nephews) if we speak to her in English or French. She just won’t speak to anyone in Creole anymore.</p>
<p>It was my dad who told me this, and when I asked why, he muttered something about Creole being a low language. What do you mean, I pressed.</p>
<p>“A low language”, my dad said again. “You know, without proper verbs and things like that.”</p>
<p>Creole, the language that my Mauritian family speak with one another, is a patois – a variation on French. That’s what I’ve always been told, anyway. Google tells me something else: that it’s a mix of a European with “local” languages, especially African languages spoken by slaves in the West Indies – this is mentioned discretely, in brackets. </p>
<p>Like my auntie, Google also privileges French. </p>
<p>And while there is no official language stipulated by the Mauritian constitution, in places like Parliament, the chosen languages are English and French, despite the fact that <a href="https://www.sunresortshotels.com/en/newsroom/cultural-diversity-history-mauritius">86.5% of the population</a> speak Creole. </p>
<p>In not wanting to speak Creole, my auntie is merely doing what her country asks of her. She is also doing what her mother asked of her. Despite her Chinese husband and surname, my grandmère taught her children to speak French, but not Chinese. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/renaming-english-does-the-world-language-need-a-new-name-14763">Renaming English: does the world language need a new name?</a>
</strong>
</em>
</p>
<hr>
<p>Growing up, I could count to ten in Cantonese, and the only phrases I knew were “wash your bum”, “wash your vagina” and “wash your penis”. These were the height of our pre-teen insults. Once, in anger, I told my father to “<em>gong hei fat choy</em>”. He laughed. “What’s so funny?” I asked in indignation. “I just told you to leave me alone.”</p>
<p>“No you didn’t. You wished me a happy new year.”</p>
<p>But when it came to French, my grandmère schooled us on the intricacies of pronunciation. Her favourite grandkids were the ones who pronounced the words flawlessly, with a French tongue. Like everyone else in my family, Grandmère spoke Creole most – but for her, French was the language in which she wasn’t just seen as poor and brown, and she made sure all her children could speak it. As though the language were a cloak that could be thrown over them all, allowing them to pass, for a moment, as something they weren’t.</p>
<p>I loved my grandmère. There was a pillowy warmth about her. She smiled easily. She pulled us onto her lap and sang us songs and told us stories. She went to church every week, carried ten babies in her womb and buried two. When she and her family lived in Mauritius, she rose at 5am and worked until 11pm making manioc (tapioca). This meant cutting, peeling, grating and draining cassava, soaking it for days, straining and kneading and drying it. My aunts would get up and work with her before going to school for the day, their hands still bleeding.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/432526/original/file-20211117-17-15zw1aw.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/432526/original/file-20211117-17-15zw1aw.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/432526/original/file-20211117-17-15zw1aw.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=801&fit=crop&dpr=1 600w, https://images.theconversation.com/files/432526/original/file-20211117-17-15zw1aw.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=801&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/432526/original/file-20211117-17-15zw1aw.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=801&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/432526/original/file-20211117-17-15zw1aw.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=1006&fit=crop&dpr=1 754w, https://images.theconversation.com/files/432526/original/file-20211117-17-15zw1aw.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=1006&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/432526/original/file-20211117-17-15zw1aw.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=1006&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">A photo of the author’s grandmère.</span>
<span class="attribution"><span class="license">Author provided</span></span>
</figcaption>
</figure>
<p>My grandpère’s job was cycling around Mauritius selling <a href="https://en.wikipedia.org/wiki/DDT">DDT</a> to farmers. While raising a large family, Grandpère became sick, first with tuberculosis and then with typhoid. A bucket was kept by his bed into which he vomited blood. My favourite auntie remembers vividly the bucket, the blood and the distance they were forced to keep from it.</p>
<p>This is all, of course, a way of me telling you not to judge my grandmère. I don’t judge my grandmère, or even my auntie, for privileging French over Creole. Their experiences are not my own. Neither of them had the luxury of studying for an arts degree at a university where the curriculum was taught in the language that the vast majority of the population spoke. English is a language that has been forced on us all. </p>
<p>That doesn’t make us all heard, by the way. But it suggests that we might be heard if we say the right things to the right people. </p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/432537/original/file-20211118-14-f19bs7.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/432537/original/file-20211118-14-f19bs7.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/432537/original/file-20211118-14-f19bs7.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=687&fit=crop&dpr=1 600w, https://images.theconversation.com/files/432537/original/file-20211118-14-f19bs7.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=687&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/432537/original/file-20211118-14-f19bs7.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=687&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/432537/original/file-20211118-14-f19bs7.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=863&fit=crop&dpr=1 754w, https://images.theconversation.com/files/432537/original/file-20211118-14-f19bs7.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=863&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/432537/original/file-20211118-14-f19bs7.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=863&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">The author with her Grandmere and Grandpere.</span>
<span class="attribution"><span class="license">Author provided</span></span>
</figcaption>
</figure>
<h2>Questions of identity</h2>
<p>Like most countries with a history of slavery, both real and economic – indentured workers are not enslaved physically, but they are also not free – Mauritius has deep issues around racism and identity. It has been colonised twice, first by the French and then by the English. At one point in history, slaves constituted <a href="https://mauritianarchaeology.sites.stanford.edu/history">80% of the Mauritian population</a>. </p>
<p>It’s no surprise, then, that many Mauritians were eager to emphasise their European heritage. They hold the other parts of themselves – Chinese, African, Indian – under deep water.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/treatment-of-foreign-workers-lends-a-lie-to-myth-of-the-mauritian-miracle-67180">Treatment of foreign workers lends a lie to myth of the Mauritian 'miracle'</a>
</strong>
</em>
</p>
<hr>
<p>The country was formally decolonised in 1968. It was too late for my family, who emigrated to Australia in 1969. They never got to feel what their country was like free of British rule, to exhale as (some) of its institutions became more democratic and multicultural. In coming here to escape British imperialism, they merely traded one form of racial discrimination for another.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/432542/original/file-20211118-16-1k8odx9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/432542/original/file-20211118-16-1k8odx9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/432542/original/file-20211118-16-1k8odx9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=390&fit=crop&dpr=1 600w, https://images.theconversation.com/files/432542/original/file-20211118-16-1k8odx9.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=390&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/432542/original/file-20211118-16-1k8odx9.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=390&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/432542/original/file-20211118-16-1k8odx9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=490&fit=crop&dpr=1 754w, https://images.theconversation.com/files/432542/original/file-20211118-16-1k8odx9.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=490&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/432542/original/file-20211118-16-1k8odx9.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=490&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Chinatown, Port Louis, Mauritius 1960s.</span>
<span class="attribution"><span class="source">Raouf Oderuth/ Wikimedia Commons</span>, <a class="license" href="http://creativecommons.org/licenses/by/4.0/">CC BY</a></span>
</figcaption>
</figure>
<p>This is why Grandmère insisted that her mother was light-skinned with grey eyes. This is how her story goes, though everything about us – our hair, eyes, lips, skin – suggests that this cannot be true. My grandmère’s surname before Kon-yu was Leubas (pronounced Le-bah), though this is an uncommon name and one I’ve had some difficulty tracing. </p>
<p>My Mauritian family has a history of strange names: Kon-yu is a strange name, a Chinese academic once told me. As far as she knew, Chinese names weren’t hyphenated. There aren’t many Kon-yus around the world, and we’re the only ones in Australia. If you search for Leubas and its variations, the most popular name you will find is Leuba (pronounced Loo-bar), which is a name most commonly found in Switzerland.</p>
<p>These are not our people.</p>
<p>Creole was one of the first languages I knew. A language I didn’t have to translate, but one that sat within my skin. I probably stopped speaking Creole in my early 20s when my grandmère died. I try to speak it still with my aunties, but I fumble, embarrassed, over my loss of basic words and phrases. I find myself translating from English to Creole in my mind. </p>
<p>The only time in my adult life when the language comes back to me is when I am with my children. All my lullabies are in Creole and, as it turns out, so are many of my commands. “<em>Donne moi ton li pied</em>,” I ask my son as I dress him in his pyjamas. “<em>Pa touché ça!</em>” I’ll cry out. My kids, born in Australia to two English-speaking parents, don’t know yet that they’re hearing Creole. They don’t know how low their language is. </p>
<p>The other language they hear, the other one I speak, my other first language, is Italian. This comes from my mother and from my nonna and nonno. It’s easier to put effort into relearning Italian – there are books and apps and classes. It is, as my father and auntie and grandmère have intimated, a proper language. People want to learn it. </p>
<p>Like Creole, Italian bursts out of me at odd moments. Most often at the Italian deli, where the air is thick with baccala, provolone and the sounds of words I remember, however dimly. It forces its way through, like Creole, when I am with my children. Again, lullabies and commands are sung and given in Italian. Here the languages are easy.</p>
<p>They slip out of me as though no other language stands in their way. There is no translating. There is just memory.</p>
<h2>Tying down a definition</h2>
<p>This is an uncomfortable matrix of things to be born into. Especially now, in this cultural moment when it seems as if everything must be tied down, defined. I feel a pressure, exerted from almost everywhere, to define myself in a certain way, as a woman of colour, even though this definition doesn’t quite fit. </p>
<p>I am wary of taking space from people who are defined much more categorically by their skin colour, who cannot pass. </p>
<p>And I am cautious of tying myself to a set of definitions based on my skin colour and unusual surname. When the issue is racism, then racial categorisations can only get us so far. Racism doesn’t respect geographic or religious differences. I’m also painfully aware that Mauritius is a country where the <a href="https://dictionary.cambridge.org/dictionary/english/colour-bar">colour bar</a> was instituted and wielded against its citizens. And I’ve never forgotten what Toni Morrison pointed out in <a href="https://www.goodreads.com/book/show/6149.Beloved">Beloved</a> – that “Definitions belong to the definers, not the defined”.</p>
<p>Yet, even so, sometime in early 2020, I decided to take a DNA test. I was sceptical, but curiosity got the better of me.</p>
<p>The results came during the pandemic and the first lockdown here in Melbourne. They were a brilliant moment of sunshine in days that hung greyly together. Here, at last, was the answer to who I actually was and where my family were definitely from. And yes, I know these things are not always accurate, that mistakes are made and cultures lumped clumsily together. But I was ready for a different thread of the story.</p>
<p>The results were a seismic shift in the narrative of who we are and where we are from. I found out I am Asian, but not Chinese. It turns out only a measly 2.6% of my DNA is Chinese. There is no French. None at all.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/should-i-get-my-dna-tested-we-asked-five-experts-120664">Should I get my DNA tested? We asked five experts</a>
</strong>
</em>
</p>
<hr>
<p>When I shared my DNA results with my cousins over a family group chat, they were shocked. One exclaimed, “you are more than half-Asian!” Both her parents are from Mauritius, and it reminds me that even in my own family, we categorise ourselves. I was surprised by this too, assuming my ethnicity was split down the middle, that my shorthand cultural signification was “Eurasian”. All this time, I have been far more Asian than Eur.</p>
<p>I grieved when I got these results. I grieved for the cultures I had been told I belonged to, whose traditions my family and I practised. Our love of yum cha, the little red envelopes my grandpère gave us at Chinese New Year when we were kids, the easy way I fold wonton and use chopsticks. My own Chinese surname. What had once seemed genetically and culturally solid now felt like an accident of fate. A Chinese man in the right place at the right time. </p>
<p>So where does Leubas come from? It is undeniable that both my grandmère’s names are French-sounding, but are they Creole names – Afro-French rather than European French? No one knows. And while I am used to being seen as a stranger by other people, it was quite another thing to feel like a stranger to myself. Looking at the Ethnicity Estimate in my test results, seeing myself in various coloured blobs spread out all over the world, I felt like I was from everywhere, and therefore from nowhere.</p>
<p>I am still Italian – at least that part of my history is true – but I’m a bit less Italian than I would like. I’m also 12% English, which explains, perhaps, my nonna’s blue eyes, passed down to my son, who is the only Kon-yu born with eyes this colour. The Englishness was a particular blow to me, as someone who does postcolonial work and habitually blames the English for All the Things Wrong With the World. I won’t lie. I felt the shift of the moral high ground change under my feet when I read this.</p>
<p>Mauritian didn’t even rank as an ethnicity. It can’t. Everyone from Mauritius is from somewhere else, or from many places at the same time. </p>
<h2>Stories in DNA</h2>
<p>I couldn’t speak English when I went to school, despite being born in Australia. I became aware of the differences between myself and my classmates when I was moved from a school of working-class brown kids to one filled with working-class and middle-class white kids. I was aware at the age of seven, when my new classmates kept a polite distance from me and my difference, how little control I had over the story of who I was. Like my auntie, I refused to speak Italian and Creole at home after I started school, knowing even then how tightly English needed to be cleaved to my self. That I needed it not only to get by, but to do well.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/432543/original/file-20211118-13-wvorls.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/432543/original/file-20211118-13-wvorls.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/432543/original/file-20211118-13-wvorls.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=848&fit=crop&dpr=1 600w, https://images.theconversation.com/files/432543/original/file-20211118-13-wvorls.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=848&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/432543/original/file-20211118-13-wvorls.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=848&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/432543/original/file-20211118-13-wvorls.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=1066&fit=crop&dpr=1 754w, https://images.theconversation.com/files/432543/original/file-20211118-13-wvorls.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=1066&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/432543/original/file-20211118-13-wvorls.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=1066&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">The author’s cousin, Morena, as a child.</span>
<span class="attribution"><span class="license">Author provided</span></span>
</figcaption>
</figure>
<p>With the loss of Creole and Italian I can no longer claim to be trilingual. And there are things I’ve forgotten that I want to remember. My grandmére’s stories, for one. No one in my Mauritian family remembers these stories. Not one. It’s like we lost them in the deep water between here and there, discarding them as things we no longer needed. I’ve looked for them online. I’ve bought books of Mauritian fairy tales and asked people to transcribe them. But they are not our stories. I’ve searched for African fairy tales, for Indian fairy tales, for French fairy tales. All with no luck.</p>
<p>So where am I actually from, and does it matter? The bulk of my DNA is West Asian (Turkey, Iraq, Iran, Azerbaijan) followed by South Asian (India, Pakistan, Nepal, Sri Lanka). The West Asian, I think, can be ascribed to my Italian family, who are from Sicily (a place that has a precarious relationship to Italianness at the best of times). The South Asian is something I share with another cousin who took the DNA test. And there are stories, hushed of course, of my grandpère’s mother, a Muslim woman who was either (depending on who tells the story) ostracised by her mostly Christian family, or was well-loved and died young.</p>
<p>My Ethnicity Estimate gives me 42 ethnicities. By contrast, my husband’s ethnicity comprises two major ethnic groups: Irish and Northern European. His coloured blobs sit side by side on a map. It is a map of people who were content enough to stay where they were born, who didn’t venture too far.</p>
<p>When I look at my own map, all I see is people fleeing.</p>
<p>I know that the truth doesn’t reside in a random swab of my cheek, but nor does it lie in family stories that contradict themselves. It is somewhere else, secret and hidden. The hiding makes me sad. The fact that my family come from places they want to keep hidden. The fact that we are a family devoid of lore. Nobody knows anything definite about my great-grandparents, and information about my grandparents is scarce. Where did Grandmère and Grandpère meet? I asked my favourite auntie, the one who cleaved to her mother, who listened actively for information. She couldn’t say because she didn’t know. </p>
<p>There is grief here, to be part of a family who have hidden themselves from recent history. Who can’t trace their lineage back more than two generations before the trail wisps into nothing. Who are probably not spelling either of their surnames (Grandmère’s or Grandpère’s) properly. </p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/432544/original/file-20211118-21-1fk7aa0.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/432544/original/file-20211118-21-1fk7aa0.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/432544/original/file-20211118-21-1fk7aa0.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=600&fit=crop&dpr=1 600w, https://images.theconversation.com/files/432544/original/file-20211118-21-1fk7aa0.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=600&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/432544/original/file-20211118-21-1fk7aa0.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=600&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/432544/original/file-20211118-21-1fk7aa0.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=754&fit=crop&dpr=1 754w, https://images.theconversation.com/files/432544/original/file-20211118-21-1fk7aa0.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=754&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/432544/original/file-20211118-21-1fk7aa0.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=754&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">The author’s dad as a child.</span>
<span class="attribution"><span class="license">Author provided</span></span>
</figcaption>
</figure>
<p>Along with the sadness and loss I feel, I am lucky enough to see an exit here. To think about how this multiplicity is not all bad. As an academic and writer, I have always been interested in the in-between and how it can trouble the things surrounding it. And I am bothered by the push in our culture to define ourselves as one thing and not another. </p>
<p>The idea of one thing and not another has been used against us all our lives. To buy into this binary, to use it against ourselves, is to enact a kind of violence. To let it in, under our skin. As Audre Lorde <a href="https://www.penguin.com.au/books/the-masters-tools-will-never-dismantle-the-masters-house-9780241339725">told us</a>, “The master’s tools will never dismantle the master’s house. They may allow us temporarily to beat him at his own game, but they will never enable us to bring about genuine change.”</p>
<p>As sociologist Malenn Oodiah <a href="https://www.luxury-in-mauritius.com/people/the-mauritian-identity-the-result-of-a-long-journey">writes</a> of the Mauritian identity, “Our cultural and religious differences constitute our wealth. Looking for a single identity is impoverishing.” For me, it means inhabiting, however precariously, all of my ethnicities and owning all my family stories, however misguidedly they have been forged. To listen to my family in whatever language they choose to speak. I have to be comfortable living in between because it is the only place I actually belong. </p>
<p>Everything I’ve been told about my family is wrong and everything I’ve been told about my family is right. We belong here and there, on many different continents and in the vast, unknown waters between them.</p>
<hr>
<p><em>This piece is an edited extract, republished with permission from <a href="https://www.griffithreview.com/editions/escape-routes/">GriffithReview74: Escape Routes</a> edited by Ashley Hay</em></p><img src="https://counter.theconversation.com/content/171393/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Natalie Kon-yu does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>My family is Mauritian, but when I take a DNA test, Mauritian didn’t even rank as an ethnicity. It can’t. Everyone from Mauritius is from somewhere else, or from many places at the same time.Natalie Kon-yu, Lecturer in Creative and Professionaln, Literature and Gender Studies, Victoria UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1585332021-04-12T19:19:05Z2021-04-12T19:19:05ZThe One: could DNA tests find our soulmate? We study sex and sexuality — and think the idea is ridiculous<figure><img src="https://images.theconversation.com/files/394395/original/file-20210411-13-j4tfpk.jpg?ixlib=rb-1.1.0&rect=17%2C0%2C5959%2C3987&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">
</span> <span class="attribution"><span class="source">Robert Viglasky/Netflix</span></span></figcaption></figure><p>The Netflix drama <a href="https://www.imdb.com/title/tt13879466/">The One</a> centres around a geneticist who invents a new matchmaking service. It uses DNA to help people find their romantic and sexual match: their “one”. </p>
<p>“A single strand of hair is all it takes to be matched with the one person you are genetically guaranteed to fall in love with”, says Dr Rebecca Webb (Hannah Ware).
“The moment you meet your match, your one true love, nothing will ever be the same again.”</p>
<p>The One asks what would happen if we could use a DNA database to match “soulmates”. More importantly, it assumes if such technology existed it would be a wholly commercial enterprise — imagining a not-to-distant future where tech (and tech giants) mediate dating, sex and relationships.</p>
<p>So, is this future just around the corner?</p>
<figure>
<iframe width="440" height="260" src="https://www.youtube.com/embed/yGgbNCkJqSM?wmode=transparent&start=0" frameborder="0" allowfullscreen=""></iframe>
</figure>
<h2>The popularity of home DNA testing</h2>
<p>Home DNA testing is now a massive business. It is estimated that by 2022 it will be worth over <a href="https://www.triplepundit.com/story/2018/dna-testing-popular-many-are-unaware-privacy-concerns/55936">US$10 billion</a> globally. </p>
<p>DNA testing companies have fuelled a <a href="https://www.salon.com/2018/06/23/americas-isolated-culture-may-explain-popularity-of-dna-testing/">cultural fascination</a> with biology, in which genetic dispositions are conflated with identity. DNA is regarded by some as the <a href="https://www.theguardian.com/science/2017/nov/19/human-evolution-dna-revolution-mapping-genome">secret to understanding</a> who we fundamentally are as people. </p>
<p>DNA kits have been sold to explore <a href="https://www.usatoday.com/story/tech/2019/07/04/is-23-andme-ancestry-dna-testing-worth-it/1561984001/">genetic and cultural history</a>, to tailor <a href="https://www.scientificamerican.com/article/matching-dna-to-a-diet-does-not-work/">diets</a>, and to look at <a href="https://www.everydayhealth.com/cancer/what-to-know-before-you-buy-an-at-home-genetic-cancer-risk-test/">genetic health risks</a>.</p>
<p>Indeed, companies such as Canada’s <a href="https://www.dnaromance.com/">DNA Romance</a> and <a href="https://instantchemistry.com/">Instant Chemistry</a> already claim to help people find love and sexual compatibility through DNA tests.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/394421/original/file-20210412-15-145w50f.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="A woman on stage, looking at a vial" src="https://images.theconversation.com/files/394421/original/file-20210412-15-145w50f.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/394421/original/file-20210412-15-145w50f.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/394421/original/file-20210412-15-145w50f.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/394421/original/file-20210412-15-145w50f.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/394421/original/file-20210412-15-145w50f.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/394421/original/file-20210412-15-145w50f.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/394421/original/file-20210412-15-145w50f.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">The One’s DNA test isn’t wholly a product of science fiction.</span>
<span class="attribution"><span class="source">Netflix</span></span>
</figcaption>
</figure>
<p>People send in saliva swaps, and their DNA is tested to <a href="https://en.wikipedia.org/wiki/Genotyping">genotype</a> human leukocyte antigens, also known as the <a href="https://www.britannica.com/science/major-histocompatibility-complex">major histocompatibility complex</a>. These are important regulators of the immune system, which also impact our body odour. Genotyping identifies which variants of these genes each of us carry – which <a href="https://www.nature.com/articles/srep32550">supposedly</a> determine who we are attracted to. </p>
<p>Companies claim to <a href="https://www.marsdd.com/news/instant-chemistry-relationship-genetic-testing/">match people</a> on the basis of this test for the best genetic love match. </p>
<p>There is <a href="https://www.nature.com/articles/srep32550">no compelling evidence</a> as to whether or not DNA matching can support a more fulfilling love life. These current tests on major histocompatability complex are based on limited experiments with mixed results.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/does-singld-out-a-gene-based-dating-service-pass-the-sniff-test-31344">Does Singld Out, a gene-based dating service, pass the sniff test?</a>
</strong>
</em>
</p>
<hr>
<p>Indeed for most things, home DNA testing isn’t scientifically advanced enough to give us true insights. It also comes with <a href="https://www.yourgenome.org/debates/is-it-ethical-to-have-a-national-dna-database">ethical concerns</a> such as fears over <a href="https://www.helpnetsecurity.com/2018/01/17/hospital-ransomware/">data hacking</a>, <a href="https://www.theverge.com/2017/3/20/14880400/politics-law-bioethics-genetic-privacy-discrimination-gina-workplace-wellness">bodily autonomy</a> in relation to who owns DNA data, and <a href="https://bmcmedethics.biomedcentral.com/articles/10.1186/s12910-016-0101-9">the accuracy of the data provided</a>. </p>
<h2>Nature versus nurture</h2>
<p>The One reflects society’s current interest in understanding our DNA as essential to our social and cultural practices. This has significant implications for diversity and acceptance. The TV series relies on the idea that romantic and sexual destiny is <a href="https://www.theguardian.com/science/2015/mar/19/do-your-genes-determine-your-entire-life">predetermined by biological makeup</a>. </p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/394422/original/file-20210412-19-8lejog.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="A couple walks down a street on a date." src="https://images.theconversation.com/files/394422/original/file-20210412-19-8lejog.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/394422/original/file-20210412-19-8lejog.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=300&fit=crop&dpr=1 600w, https://images.theconversation.com/files/394422/original/file-20210412-19-8lejog.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=300&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/394422/original/file-20210412-19-8lejog.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=300&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/394422/original/file-20210412-19-8lejog.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=377&fit=crop&dpr=1 754w, https://images.theconversation.com/files/394422/original/file-20210412-19-8lejog.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=377&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/394422/original/file-20210412-19-8lejog.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=377&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">We — and our relationships — aren’t just a product of our genes.</span>
<span class="attribution"><span class="source">Netflix</span></span>
</figcaption>
</figure>
<p>Characters in The One feel intense attraction to their match. While it pokes fun at this idea — one character continues extramarital affairs despite being married to their match, another has multiple matches — the romantic ideal of The One is still committed to the possibility of “soulmates”.</p>
<p>This imagined possibility helps to entrench the notion that monogamy is the most “natural” human relationship and human sexuality is <a href="https://www.tandfonline.com/doi/abs/10.1080/00224499809551913">pre-determined, fixed and rigid</a>. But human <a href="https://theconversation.com/explainer-what-is-sexual-fluidity-33120">sexuality is fluid</a>, influenced by our culture and society.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/explainer-what-is-sexual-fluidity-33120">Explainer: what is sexual fluidity?</a>
</strong>
</em>
</p>
<hr>
<p>Similar to the controversial search for “<a href="https://www.sfchronicle.com/health/article/Scientists-combing-human-DNA-for-gay-genes-spark-14403547.php">The Gay Gene</a>”, the world envisaged by The One takes <a href="https://journals.sagepub.com/doi/pdf/10.1177/0038038507080445">politics out of human relationships and sex</a>. </p>
<p>Social norms restrict and shape how we engage with sex and relationships: <a href="https://theconversation.com/madonna-or-whore-frigid-or-a-slut-why-women-are-still-bearing-the-brunt-of-sexual-slurs-99292">slut-shaming for women</a> may mean women are reluctant to seek out pleasure and connections; <a href="https://link.springer.com/article/10.1007/s11199-019-01024-0">sexual aggressions</a> may mean reproduction of gender inequalities and <a href="https://theconversation.com/australians-still-trivialise-and-excuse-violence-against-women-31420">intimate partner violence</a>. Alternate relationship styles, such as <a href="https://www.healthline.com/health/polyamorous">polyamory</a>, or the choice to remain partner-free, are positioned as “unnatural” or less valid. </p>
<p>We still live in an age where <a href="https://www.pewresearch.org/global/2020/06/25/global-divide-on-homosexuality-persists/">LGBTIQA+ rights</a> are contested, and non-monogamous relationship styles or <a href="https://theconversation.com/what-asexuality-can-teach-us-about-sexual-relationships-and-boundaries-94846">asexuality</a> remain <a href="https://www.psypost.org/2020/03/study-sheds-light-on-the-roots-of-moral-stigma-against-consensual-non-monogamy-56013">stigmatised</a>. </p>
<p>It is dangerous to assume DNA matching holds the key to romantic and sexual success — our genes alone cannot account for these diverse life experiences. </p>
<h2>Anxieties of dating may not be solved through DNA</h2>
<p>The dating app industry alone is <a href="https://www.prnewswire.com/news-releases/online-dating-market-size-is-projected-to-reach-usd-3-592-billion-by-2025---valuates-reports-301146610.html">projected to grow</a> to 3.925 billion users worldwide by 2025. </p>
<p>However apps have been blamed by some for <a href="https://www.insider.com/dating-apps-are-destroying-love-2018-8">facilitating</a> superficial attitudes to sex and dating, such as fostering <a href="https://www.lifehacker.com.au/2019/03/how-tinder-turns-everyone-into-a-cheater/">infidelity</a>; the phenomena of <a href="https://www.huffpost.com/entry/the-psychology-of-ghostin_b_7999858#:%7E:text=%22Ghosting%22%20is%20when%20someone%20you,re%20in%20a%20committed%20relationship.">ghosting</a> and <a href="https://www.cybersmile.org/what-we-do/advice-help/catfishing">catfishing</a>; and the paralysis of <a href="https://www.psychologytoday.com/au/blog/why-bad-looks-good/201705/online-too-many-dating-choices-decreases-commitment">too much choice</a>. </p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/394420/original/file-20210412-21-1mpklu1.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="A man holds a sign: A Match Made In Hell" src="https://images.theconversation.com/files/394420/original/file-20210412-21-1mpklu1.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/394420/original/file-20210412-21-1mpklu1.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/394420/original/file-20210412-21-1mpklu1.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/394420/original/file-20210412-21-1mpklu1.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/394420/original/file-20210412-21-1mpklu1.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/394420/original/file-20210412-21-1mpklu1.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/394420/original/file-20210412-21-1mpklu1.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">The One suggests you may be able to find your true love with DNA testing — but this doesn’t mean you will like them.</span>
<span class="attribution"><span class="source">James Pardon/Netflix</span></span>
</figcaption>
</figure>
<p>New technologies, like apps, can <a href="https://www.theatlantic.com/family/archive/2018/12/tinder-changed-dating/578698/">reshape</a> romance. The One largely envisages DNA matching would reaffirm old moral standards and expectations for the ideal relationship: monogamous, lifelong, intense and perfect.</p>
<p>Humans tend to presume DNA and genetic testing can provide us with <a href="https://www.psychologytoday.com/au/blog/the-lost-family/202010/why-are-americans-obsessed-genealogy">irrefutable certainty</a>. But relying on DNA ignores the role <a href="https://www.cambridge.org/core/books/social-influence-on-close-relationships/4C627F7E587E9166B5664B782C0C37A2">society and politics</a> have in shaping our lives. Who we choose to have a relationship with may be influenced by our life goals and experiences, personal desires, morals and values, cultures and heritages.</p>
<p>The idea you can meet a DNA-certified companion to avoid heartbreak is seductive and comforting — but the truth is life and relationships are just too messy.</p><img src="https://counter.theconversation.com/content/158533/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Andrea Waling receives funding from the Australian Research Council. </span></em></p><p class="fine-print"><em><span>Jennifer Power receives funding from the Australian Department of Health, the Victorian Government and the Australian Research Council. She has previously received funding from ViiV healthcare. </span></em></p>This Netflix series imagines we all have a DNA-compatible soulmate waiting for us. But while there are companies in the real world matchmaking via DNA, love is more complex than that.Andrea Waling, ARC DECRA Senior Research Fellow in Sex & Sexuality, La Trobe UniversityJennifer Power, Associate Professor and Principal Research Fellow at the Australian Research Centre in Sex, Health and Society, La Trobe UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1485822020-11-22T09:13:02Z2020-11-22T09:13:02ZHow South Africans can use their DNA to be good genomic citizens<figure><img src="https://images.theconversation.com/files/366407/original/file-20201029-19-1qhonhh.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">Direct-to-consumer genetic testing can help scientific researchers.</span> <span class="attribution"><span class="source">Andrey_Popov/Shutterstock</span></span></figcaption></figure><p>In the past few years, people have become fascinated with using their DNA to learn more about themselves, their origins, family trees, predisposition to health conditions and quirky traits. This has been enabled by the rise in popularity and the relative affordability of direct-to-consumer ancestry testing in places like the US. This testing allows people to swab their mouths to collect cells containing DNA, which are then sent off to companies for testing and analysis.</p>
<p>Today sites like AncestryDNA, 23andMe, MyHeritage and FTDNA dominate the European and US markets. But until recently, this service has been inaccessible to most South Africans. That’s because testing using overseas companies can be expensive, and there are logistical hurdles to shipping sample collection kits into and out of South Africa.</p>
<p>Recently, local companies like <a href="https://dnalysis.co.za/">DNAnalysis</a> and <a href="https://www.behappytobeyou.co.za/">Be Happy To Be You</a> have started to offer genetic testing, ranging from ancestry to nutrigenetics (what your genes say you should and should not eat) and health screenings.</p>
<p>Many potential clients are, however, sceptical about using these services. They view them as sub-standard and more expensive than some of the larger, overseas competitors. There are also concerns regarding privacy.</p>
<p>So, is supporting local businesses – and getting your DNA analysed – worth it? My opinion, as a human population geneticist who <a href="https://link.springer.com/article/10.1007/s00438-020-01684-8">has researched</a> the role that extensive genetic testing can play in mapping diseases, is “yes”. As more clients choose a local service provider for direct-to-consumer testing, the accuracy of the service will increase, the costs will decrease and the resulting data generation can be used to boost medical research efforts.</p>
<h2>Addressing concerns</h2>
<p>The process of completing a direct-to-consumer ancestry test is fairly simple. When you visit a site and request a test, you will be required to sign a consent form, fill in your personal information (contact details and address) and then wait for your test kit to be couriered to you. This kit is used to swab the inside of your mouth. The swabs are then sent back to the company for further processing, which involves extraction of your DNA and then computational analysis. An ancestry report is generated by comparing your genetic data to data of other worldwide populations.</p>
<p>But what of people’s concerns around accuracy, cost and privacy?</p>
<p>Firstly, there is no evidence that the services offered by local companies are sub-par. In fact, they should be more accurate because of the context in which the data is analysed. Local companies will have databases of South African data that other overseas companies do not. For example, instead of containing two different southern African populations (in line with overseas companies), local companies might have 10 and therefore be able to provide more detailed, granular reports.</p>
<p>Furthermore, scientists who work in local companies have acquired local knowledge and are therefore able to work with South Africa’s unique genetic diversity better than anyone else.</p>
<p>Secondly, testing in South Africa is for the most part not more expensive than overseas. If South Africans use an overseas company, they’ll generally have to pay for courier fees to get a sample collection kit delivered and sent back to the company as well as potentially paying import taxes. There’s also a risk that the sample collection kit might get held up or even lost in either direction of the courier process. This may add to the overall cost. </p>
<p>Typically the price for direct-to-consumer ancestry testing in the US is between $69 and $99. Adding approximately R800 (around $50) for courier charges brings the cost for an international test to between R1,900 and R2,400, compared to between R1,000 and R2,499 locally (courier fees included). And, as more and more people start using local resources, the products and services will become cheaper over time.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/what-weve-learnt-from-building-africas-biggest-genome-library-126293">What we've learnt from building Africa's biggest genome library</a>
</strong>
</em>
</p>
<hr>
<p>With regard to data privacy, confidentiality and anonymity, South Africa has some of the strictest laws that govern personal data, particularly the <a href="https://www.gov.za/documents/protection-personal-information-act?gclid=CjwKCAjw0On8BRAgEiwAincsHOOlBCOVBQmw8rQLAoK0h-YyOTbs_Zlytr-Qe3CouEWwnaAKXFN5LxoCrScQAvD_BwE">Protection of Personal Information Act</a>. All local companies are required to adhere to this.</p>
<p>There is another aspect South Africans should consider when they’re thinking about using local services for genomic testing: the importance of creating a genomic citizenship movement.</p>
<h2>Benefits for all</h2>
<p>When you send your DNA to a direct-to-consumer genetic testing company, you are investing in a product and service that benefits others. By making your de-identified genetic data available for use in local companies’ databases and for research purposes, you directly contribute to scientific development by increasing the accuracy of these services for other clients and in some cases, for yourself and for your family members. </p>
<p>Scientific researchers can use that de-identified data to investigate, for instance, why some individuals get sick and others don’t. An example of this has been seen during the COVID-19 pandemic. Genetic data from direct-to-consumer genetic testing has been used <a href="https://www.medrxiv.org/content/10.1101/2020.09.04.20188318v1">to investigate how the disease progresses</a> and why some patients are asymptomatic while others succumb to the disease. This was made possible by individuals who allowed researchers to use their genetic data for this purpose.</p>
<p>Over time, with an expansion of genetic data, it will be possible to diagnose patients with genetic diseases that would not have been diagnosed otherwise. Scientists will be able to answer questions regarding the efficacy of medications in some patients and speed up the development of gene therapies that could save countless lives.</p>
<p>The rise of direct-to-consumer services is an opportunity for South Africans to contribute, in their own way, to a greater genomic future.</p><img src="https://counter.theconversation.com/content/148582/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Caitlin Uren consults for private individuals as well as for Artisan Biomed, the company that owns Be Happy To Be You. </span></em></p>Scientists who work in local companies have acquired local knowledge and are therefore able to work with South Africa’s unique genetic diversity better than anyone else.Caitlin Uren, Postdoctoral research fellow, Stellenbosch UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1493722020-11-16T15:00:20Z2020-11-16T15:00:20ZMassive project on African DNA sets out to close the knowledge gap on mental illness<figure><img src="https://images.theconversation.com/files/368591/original/file-20201110-15-31w2di.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">It has long been recognised that mental disorders can run in families. And often members of such families differ in their symptoms.
</span> <span class="attribution"><span class="source">Getty Images</span></span></figcaption></figure><p>In July 2009, a woman brought her husband to the hospital where our colleagues work in western Kenya. She reported that for several years he had been behaving abnormally, sleeping poorly, hearing voices that no one else could hear, and believing that people were talking about him and plotting to harm him.</p>
<p>She was seeking help because he was no longer able to work. The man was admitted to the inpatient Mental Health Unit and diagnosed with schizophrenia.</p>
<p>Then the man’s daughter came to visit him. Her clothes and her hair were dishevelled. She described people plotting against her and giving her dirty looks when she walked in the street. She said she was having trouble sleeping. The clinicians looked at each other with apprehension: Might she have schizophrenia too?</p>
<p>Ultimately, the daughter and four more members of the family were diagnosed with schizophrenia. While having six members of the same family diagnosed with schizophrenia is unusual, it has long been recognised that mental disorders can run in families. And often members of such families differ in their symptoms.</p>
<p>For reasons that we are just beginning to understand, one family member might be diagnosed with schizophrenia and another with bipolar disorder or depression. In Eldoret, Kenya, where this health facility is located, it is not unusual to have two or three relatives receiving care for mental illnesses. </p>
<p>Such an occurrence is not unique. Research has found that severe mental illness is <a href="https://www.biologicalpsychiatryjournal.com/article/S0006-3223(17)31905-4/fulltext">influenced by genes more than by any other risk factor</a>. And genes are emerging as important clues for new treatments.</p>
<p>But research on the genetic basis of mental illness has <a href="https://doi.org/10.1016/j.cell.2019.08.051">so far</a> largely excluded populations that are not of European heritage. That means that this Kenyan family, and other people of African descent, might not benefit from the new biological insights into mental illness. </p>
<p>To help remedy this problem in psychiatric research, researchers from the United States and four countries in Africa are working together to<a href="https://www.broadinstitute.org/schizophrenia-study-africa-boosting-equity-global-genetics-research"> study the genetics of schizophrenia and bipolar disorder</a>. They are drawn from the Harvard T.H. Chan School of Public Health and the Broad Institute of MIT in the US, Moi University and KEMRI-Wellcome Trust in Kenya, Makerere University in Uganda and Addis Ababa University in Ethiopia. Rounding out southern Africa is the team from the University of Cape Town.</p>
<p>The initiative aims to do something that has never been done on this scale before: recruit 35,000 people in Ethiopia, Kenya, South Africa and Uganda to answer questions about their health, lifestyle and mental illness, and donate two teaspoons of saliva for DNA testing.</p>
<h2>Diversity problem</h2>
<p>The finding that severe and chronic mental illnesses tend to cluster in families has spurred efforts to understand the genetic differences between people with these illnesses and those without. By looking at DNA and untangling what is going awry in the brain to cause these mental disorders, we hope to spur the creation of new medications to treat these debilitating illnesses and reduce the suffering that comes with them.</p>
<p>Unfortunately, recent efforts to study the genetics of a number of illnesses have what many of us are calling a <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5089703/">“diversity problem</a>.” Most of the work in human genetics so far has focused on people of Northern European descent, skewing the data in a way that makes it less useful to the majority of people in the world. </p>
<p>The world is perilously close to an era of “<a href="https://www.technologyreview.com/s/612322/white-people-only-dna-tests-show-how-unequal-science-has-become/">white-people-only DNA tests.</a>” In existing databases, 78% of the DNA data comes from <a href="https://www.cell.com/cell/pdf/S0092-8674(19)30231-4.pdf">people of European ancestries</a>, who make up only about 16% of the world’s population.</p>
<p>One of the main issues presented by this diversity problem is that any solutions (including new medications) are likely to work best for the people whose DNA the research was based on – people of European descent. In fact, most residents in a diverse city like the US city of Boston, made up of white, black, Hispanic and Asian people among others, may not benefit the way they could from research efforts emanating from only a section of the world’s population.</p>
<h2>Potential targets for new medicines</h2>
<p>Our large collaborative effort in Africa is called Neuropsychiatric Genetics of African Populations-Psychosis, “NeuroGAP-Psychosis” for short.</p>
<p>With the data collected from the 35,000 people recruited for the project we will be looking for important, clinically relevant genetic differences that might be found in people of African descent and may be less common in people of European descent.</p>
<p>The information could lead to potential targets for new medicines that will help people of African descent and likely people of all ancestries around the globe due to the way human populations <a href="https://www.pnas.org/content/109/44/17758">originated in Africa</a> and migrated to other continents.</p>
<p>In truth, genetics research cannot be done effectively in a narrow slice of humanity. Our hope is that the genetic data found in the NeuroGAP-Psychosis study, and in similar studies underway in Mexico, China, Japan, Finland and many other countries, will be combined to help solve the mystery of the causes of schizophrenia and bipolar disorder.</p>
<p>Our greatest wish? To see better treatments reach all people suffering from severe mental illness, whether they are in western Kenya or in Boston.</p>
<p><em>A version of this article originally appeared on WBUR’s CommonHealth under the title, <a href="https://www.wbur.org/commonhealth/2019/08/13/solving-diversity-problem-schizophhrenia-genetics-research">“Moving Away from ‘White People Only’ DNA Tests: African Project Seeks Thousands for Mental Health Genetics.”</a></em></p><img src="https://counter.theconversation.com/content/149372/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Lukoye Atwoli receives funding from the Broad Institute of MIT and Harvard for this work. He is also funded by the National Institutes of Health on other projects.
Lukoye does not receive any funding from any entity that would benefit from this article, and he has no conflicts of interest to declare.</span></em></p><p class="fine-print"><em><span>Anne Stevenson and the NeuroGAP-Psychosis study are supported, in part, by the United States' National Institute for Mental Health.
Anne does not receive funding from any company or organization which would benefit from this article and has no conflicts of interest to disclose.</span></em></p>Research on the genetic basis of mental illness has so far largely excluded anyone who is not of European heritage.Lukoye Atwoli, Professor of Psychiatry and Dean, Medical College East Africa, Aga Khan University, Aga Khan University Graduate School of Media and Communications (GSMC)Anne Stevenson, Program Director, NeuroGAP-Psychosis Study, Harvard UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1296762020-02-18T22:30:46Z2020-02-18T22:30:46ZHow genetic testing is helping scientists save animals from disease and illegal hunting<figure><img src="https://images.theconversation.com/files/315559/original/file-20200214-11017-1u37l2m.jpg?ixlib=rb-1.1.0&rect=0%2C0%2C4281%2C2843&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">Genetic testing in Banff National Park showed that grizzly bears were using wildlife corridors for safe passage beneath a highway.</span> <span class="attribution"><span class="source">(Shutterstock)</span></span></figcaption></figure><p>DNA testing kits for humans and their pets are a growing business. The draw for consumers ranges from understanding why their dog looks like a Labrador but acts like a German Shepherd, or what diseases they might be prone to. </p>
<p>For a nominal fee, individuals collect saliva from their pet and mail it to the testing company. A lab extracts DNA from the sample, which is then analyzed at many sites within the genome, called <a href="https://ghr.nlm.nih.gov/primer/genomicresearch/snp">single nucleotide polymorphisms (SNPs, and pronounced snips)</a>. SNPs are places in the DNA sequence where there is a genetic variant. </p>
<p>In humans, SNPs occur approximately every 1,000 base pairs of DNA, which means there are about five million SNPs in each person. Dog testing kits may analyze more than 20,000 SNPs to determine breeds.</p>
<p><div data-react-class="InstagramEmbed" data-react-props="{"url":"https://www.instagram.com/p/B8M0FW2p5Wn/?utm_source=ig_web_copy_link","accessToken":"127105130696839|b4b75090c9688d81dfd245afe6052f20"}"></div></p>
<p>We can apply the same approaches used in these DNA testing kits to wildlife conservation and management. My research in conservation genetics has used genetic testing in several projects, including <a href="https://doi.org/10.1111/j.1365-294X.2008.03989.x">tracking raccoons’ movements to understand the spread of raccoon rabies</a>. </p>
<h2>Building wild databases</h2>
<p>Because DNA is inherited from parents, siblings will share more genetic variants with each other than they would with anyone else. The more related individuals are, the more variants they have in common. Through <a href="https://doi.org/10.1007/s00335-011-9387-6">analyzing known dog breeds</a>, DNA testing companies know which SNP variants are more common within a breed.</p>
<p>For dog testing kits to be most effective, they require a large database of DNA samples from individuals of known breeds to develop baseline data. This is a challenge for wildlife researchers because access to samples is difficult. Wildlife researchers often employ creative techniques to obtain DNA samples, such as hair traps for bear samples or collecting caribou scat.</p>
<figure>
<iframe width="440" height="260" src="https://www.youtube.com/embed/ugEEgRtw9gI?wmode=transparent&start=0" frameborder="0" allowfullscreen=""></iframe>
<figcaption><span class="caption">An unusual method to collect bear fur for genetic analysis using a ‘rub tree.’</span></figcaption>
</figure>
<p>Another obstacle is knowing where the genetic variants are found in the genomes of most wildlife species. Thankfully, the importance of genomic information for human health has driven advances in DNA sequencing. This has lowered the costs and <a href="https://doi.org/10.1111/1755-0998.12901">improved access to technology</a> that was once too expensive.</p>
<p>Knowing where individuals originate can be very important for wildlife conservation and management. For example, researchers used SNPs <a href="https://doi.org/10.1111/eva.12026">to identify different stock populations of Atlantic cod throughout the North Atlantic</a>. Their genetic assessment of populations could be used to track fisheries activities and identify illegal harvesting, which is nearly impossible to do without DNA information yet critical to ensure healthy stocks into the future.</p>
<h2>Identifying health risk factors</h2>
<p>To identify risk factors in dogs, researchers compare genetic variation in individuals with and without the disease or condition, <a href="https://doi.org/10.1371/journal.pone.0173810">such as the potentially devastating rupture of the anterior cruciate ligament</a>. These are called genome-wide association studies. </p>
<p>There are a number of examples in nature where disease is resulting in significant loss of species biodiversity. The chytrid fungus (<em>Batrachochytrium dendrobatidis</em>) <a href="https://doi.org/10.1007/s10393-010-0281-6">affects amphibian populations worldwide, resulting in global declines</a>. White-nose syndrome, caused by the fungus <em>Pseudogymnoascus destructans</em>, has <a href="https://doi.org/10.1126/science.1163874">resulted in declining bat populations in North America</a>. Chronic wasting disease, <a href="https://doi.org/10.7589/0090-3558-16.1.89">which affects deer</a>, is considered an <a href="https://doi.org/10.1016/j.tree.2017.11.006">emerging threat to global biodiversity</a>. </p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/315560/original/file-20200214-11017-ii7ayl.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/315560/original/file-20200214-11017-ii7ayl.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/315560/original/file-20200214-11017-ii7ayl.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=450&fit=crop&dpr=1 600w, https://images.theconversation.com/files/315560/original/file-20200214-11017-ii7ayl.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=450&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/315560/original/file-20200214-11017-ii7ayl.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=450&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/315560/original/file-20200214-11017-ii7ayl.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=566&fit=crop&dpr=1 754w, https://images.theconversation.com/files/315560/original/file-20200214-11017-ii7ayl.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=566&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/315560/original/file-20200214-11017-ii7ayl.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=566&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">A bat with visible symptoms typical of white nose syndrome.</span>
<span class="attribution"><a class="source" href="https://www.flickr.com/photos/50838842@N06/8509677349">(Flickr/USFWS Headquarters)</a>, <a class="license" href="http://creativecommons.org/licenses/by/4.0/">CC BY</a></span>
</figcaption>
</figure>
<p>The identification of genetic variants that are associated with disease resistance in these systems would help wildlife managers understand disease spread. This could, in turn, identify what options may be available for management of the disease and the affected species. </p>
<h2>The future of wildlife research</h2>
<p>There are a growing number of examples that demonstrate the feasibility of this approach, such as in the case of <a href="https://doi.org/10.1186/s12864-018-4452-0">infectious upper respiratory tract disease in gopher tortoises</a>. Researchers can use this information to identify tortoises that are resistant to the infection and include them in breeding programs for this endangered species.</p>
<p>The importance of genomic research for humans has helped to drive improvements in the technology that make it more cost-effective to study wildlife species. While there are a number of challenges that researchers face in using DNA, the benefits to wildlife conservation and management are clear.</p><img src="https://counter.theconversation.com/content/129676/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Catherine Cullingham receives funding from Genome Canada and the Calgary Zoo. </span></em></p>Information collected from DNA samples can be used to identify species, track their movements and diagnose genetic diseases. This information is useful in conservation and management projects.Catherine Cullingham, Assistant professor, Department of Biology, Carleton UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1299762020-01-20T19:03:29Z2020-01-20T19:03:29ZCousin took a DNA test? Courts could use it to argue you are more likely to commit crimes<figure><img src="https://images.theconversation.com/files/310114/original/file-20200115-151887-13xn95.jpg?ixlib=rb-1.1.0&rect=0%2C0%2C5414%2C3424&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">DNA from relatives could be used in sentencing offenders.</span> <span class="attribution"><span class="source">MR Yanukit / Shutterstock</span></span></figcaption></figure><p>How similar do you think you are to your second cousin? Or your estranged great aunt? </p>
<p>Would you like to have people assess your behaviour from what your great aunt has done? How would you feel if courts used data gained from them to decide how you are likely to behave in the future?</p>
<p>Scientists are making connections between a person’s DNA and their tendencies for certain kinds of behaviour. At the same time, commercial DNA databases are becoming more common and police are gaining access to them. </p>
<p>When these trends combine, genetic data inferred about offenders from their relatives might one day be used by courts to determine sentences. In the future, the data from your great aunt could be used by a court to determine how severely you are punished for a crime.</p>
<h2>DNA databases can be used to identify relatives of criminals</h2>
<p>A Florida judge recently approved a warrant to search a genetic genealogy database, <a href="http://www.gedmatch.com/">GED Match</a>. This American company has <a href="https://www.thetelegraph.com/news/article/Florida-judge-grants-police-warrant-to-access-14823041.php">approximately 1.3 million users</a> who have uploaded their personal genetic data, with the assumption of privacy, in the hope of discovering their family tree. </p>
<p>The court directly overruled these users’ request for privacy and now the company is obliged to hand over the data.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/if-youve-given-your-dna-to-a-dna-database-us-police-may-now-have-access-to-it-126680">If you've given your DNA to a DNA database, US police may now have access to it</a>
</strong>
</em>
</p>
<hr>
<p>Police can search through the genetic database to identify people who are likely to be relatives of a person who left DNA at a crime scene. Then, by creating a family tree, police may be able to work out the probable identity of the criminal they are looking for. </p>
<p>This is how the infamous Golden State Killer was <a href="https://www.theatlantic.com/science/archive/2018/04/golden-state-killer-east-area-rapist-dna-genealogy/559070/">identified</a>, many years after his serial killings.</p>
<h2>Genealogy databases and sentencing</h2>
<p>So far, prosecutors have used DNA evidence to persuade courts that a defendant was present at the scene of a crime and is likely to have committed it. But what if they want to use DNA evidence at sentencing to show the defendant is dangerous, and thus merits a longer sentence?</p>
<p>Genetic information – including from relatives – can be used not just to identify who you are, but to work out your likely behavioural and psychological features. The science is still in its infancy, but many traits are influenced by one’s DNA, including <a href="https://www.nature.com/articles/s41398-019-0513-7">aggression</a>. </p>
<p>This DNA information may well be used in the criminal justice system, in order to predict how a person may behave in the future.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/dna-database-sold-to-help-law-enforcement-crack-cold-cases-128674">DNA database sold to help law-enforcement crack cold cases</a>
</strong>
</em>
</p>
<hr>
<p>Let’s assume the prosecution wants to show an offender is dangerous. Some <a href="https://science.sciencemag.org/content/297/5582/851">research</a> has suggested males with a low-activity monoamine oxidase A gene (MAOA), who experienced maltreatment when young, are significantly more likely to be impulsive and aggressive than the general population. </p>
<p>So if genetic data inferred from an offender’s relatives in a database suggests they have low-activity MAOA, and there is evidence about the offender’s adverse childhood, an expert witness might argue their likely impulsivity and aggression presents an increased risk of future violence. </p>
<p>This might be used by the prosecution to make the case for a longer sentence. In some jurisdictions and circumstances, the prosecution may have a means of obtaining a sample of DNA directly from the offender. But where this is not legally possible without the offender’s consent, the inference from relatives might fill a gap in the prosecution’s case about how dangerous the offender is.</p>
<p>In short, the prosecution may be able to discover previously private information about offenders, which could be used in creative and concerning ways to argue for more severe punishment.</p>
<h2>Reasons to be concerned</h2>
<p>The stumble towards using this technology is unsettling on several fronts. It seems to provide luck with a disconcerting role in punishment. Should the way our carers treated us when we were young, and the genetic constitution of relatives (perhaps even those who we have never met), really have a significant role in how we are evaluated and sentenced? </p>
<p>A second issue is privacy. When you contribute your DNA to a genetic genealogy database, are you happy with the thought that your contribution might be used in criminal proceedings against a relative to argue for an extra year to be added to their sentence? </p>
<p>Once the DNA data is submitted, courts, governments, and businesses for generations to come will be able to infer the genetic constitution of your relatives.</p>
<p>Companies that collect genetic data, <a href="https://www.23andme.com/">23andMe</a> and <a href="https://www.ancestry.com/">Ancestry.com</a>, make a profit through selling it to researchers and other companies. The monetisation of this data is already under way, with 23andMe last week <a href="https://www.bloomberg.com/news/articles/2020-01-09/23andme-licenses-drug-compound-to-spanish-drugmaker-almirall?in_source=postr_story_0">announcing</a> they are licensing a drug created using their databases.</p>
<p>Since the Cambridge Analytica scandal there is good reason to worry about the dangers of businesses like these, which collect highly detailed information about the public in order to sell it for a profit.</p>
<p>Next time your family gathers together, you might want to discuss some of these issues. Who do you want to have your genetic data for generations to come? And how do you want it to be used?</p><img src="https://counter.theconversation.com/content/129976/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>The authors do not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and have disclosed no relevant affiliations beyond their academic appointment.</span></em></p>When DNA databases and behavioural genetics combine, your family’s genes could play a role in criminal sentencingAllan McCay, Law Teacher, University of SydneyChristopher Lean, Postdoctoral research associate, University of SydneyLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1286742019-12-22T10:53:12Z2019-12-22T10:53:12ZDNA database sold to help law-enforcement crack cold cases<figure><img src="https://images.theconversation.com/files/308020/original/file-20191219-11939-15ikayv.jpg?ixlib=rb-1.1.0&rect=0%2C0%2C7452%2C5065&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">Individuals who upload their DNA test results to databases may not have much control over how it's used. </span> <span class="attribution"><span class="source">(Shutterstock)</span></span></figcaption></figure><p>During the Christmas season, genetic genealogy companies offer discounts on testing kits. We should be increasingly concerned <a href="https://theconversation.com/dna-tests-make-fun-holiday-gifts-but-beware-of-the-hype-127607">not only about the accuracy of the tests</a> but also about giving the gift that gives away all the family DNA. </p>
<p>On Dec. 9, 2019, genealogists using GEDmatch, a free online tool that compares DNA test results, were surprised to find out that the genealogy database had been bought by Verogen, a company that manufactures forensic lab instruments for law enforcement.</p>
<p>The road to this purchase started last spring when genealogists who had uploaded their data to GEDmatch found out detectives <a href="https://theconversation.com/how-cops-used-a-public-genealogy-database-in-the-golden-state-killer-case-95842">had mined their data to crack a cold case</a>. </p>
<p>The phenomenon of solving cold cases using free DNA data provided by the generous sharing instincts of genealogists quickly got taken up as a for-profit venture. Almost 100 cold-cases <a href="https://www.nytimes.com/2019/04/25/us/golden-state-killer-dna.html">have been solved</a> by a combination of genetic and genealogical sleuthing — and some surreptitious sampling by police officers. </p>
<p>Tissues, coffee cups, straws and cigarette butts are rich sources of discarded DNA. Tracking down the cold cases of cold-blooded killers has been a triumph for law enforcement — a miracle for long-suffering families — but it is also a privacy nightmare. </p>
<p><a href="https://www.wired.com/story/dna-crime-solving-is-still-new-yet-it-may-have-gone-too-far/">Two controversial cases</a> made users and observers wonder about the limits of police intrusion.</p>
<h2>Privacy and police intrusion</h2>
<p>The whole point of genetic genealogical testing is to trace your lost biological kin and 800 or so genetic relatives. DNA on its own isn’t very useful; it’s the identified family trees of those genetic relations that are so valuable. </p>
<p>GEDmatch was a database with fewer privacy provisions and thus more relative matches than commercial testing companies. That lax privacy policy was precisely the appeal to family historians who generously shared their genealogical and genetic data.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/how-cops-used-a-public-genealogy-database-in-the-golden-state-killer-case-95842">How cops used a public genealogy database in the Golden State Killer case</a>
</strong>
</em>
</p>
<hr>
<p>To catch the Golden State Killer, police detectives created a fake profile and uploaded cold-case DNA tests. No one was the wiser until the case broke. The founders of the site, Curt Rogers and John Olson, passionate genealogists themselves, were as surprised as their users. They reacted with confusion. Their side hobby had just taken a very unanticipated turn.</p>
<p><a href="https://www.nytimes.com/2018/10/15/science/gedmatch-genealogy-cold-cases.html">Rogers told <em>The New York Times</em>:</a>, “It’s kind of been a shock to all of us how these things developed: all of a sudden, all this notoriety.” His co-founder agreed, “I feel like I’m on a high-speed ride with no way to steer.” </p>
<p>Users reacted negatively to the use of their personal bio-data — and the data of all of their genetic relatives — without their consent. So, GEDmatch changed its privacy policy several times. </p>
<p>At first, GEDmatch, in a hurried disclaimer, defensively warned its users that their data was indeed unprotected and could be used by anyone. Some genealogists (particularly on social media) gleefully declared that they were delighted to help catch criminal relations, invoking the “I’ve got nothing to hide” line of genetic privacy ignorance. </p>
<figure class="align-center ">
<img alt="" src="https://images.theconversation.com/files/308022/original/file-20191219-11946-1xxb07g.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/308022/original/file-20191219-11946-1xxb07g.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=469&fit=crop&dpr=1 600w, https://images.theconversation.com/files/308022/original/file-20191219-11946-1xxb07g.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=469&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/308022/original/file-20191219-11946-1xxb07g.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=469&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/308022/original/file-20191219-11946-1xxb07g.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=589&fit=crop&dpr=1 754w, https://images.theconversation.com/files/308022/original/file-20191219-11946-1xxb07g.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=589&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/308022/original/file-20191219-11946-1xxb07g.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=589&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">DNA tests are winding up under the tree at Christmas.</span>
<span class="attribution"><span class="source">(Shutterstock)</span></span>
</figcaption>
</figure>
<p>But, faced with enough informed outrage, GEDmatch tightened its privacy policy. First they tried limiting police searches to violent crimes and cold-cases, but then <a href="https://www.buzzfeednews.com/article/peteraldhous/genetic-genealogy-parabon-gedmatch-assault">bent their own rules</a>. After the ensuing anger, they then they gave users the choice to <a href="https://web.archive.org/web/20190612170606/https://www.gedmatch.com/tos.htm">opt-out of police searches</a>.</p>
<p>Out of the more than 1.3 million people using GEDmatch, only 200,000 agreed to have their profiles made available for criminal searches. Having effectively killed the usefulness of the database for law enforcement, <a href="https://www.nytimes.com/2019/11/05/business/dna-database-search-warrant.html">the Orlando Police Department obtained a warrant in November that overruled any and all of GEDmatch’s privacy promises</a>. </p>
<p>Users were ambushed once again. It turned out that GEDmatch had very little privacy control. </p>
<p>As Debbie Kennett, an associate researcher at University College London, wrote: <a href="https://www.sciencedirect.com/science/article/pii/S0379073819302014?via%3Dihub">“The technology has advanced faster than our ability to introduce safeguards</a>.”</p>
<h2>Verogen promises</h2>
<p>After the CEO of Verogan, Brett Williams, courted GEDmatch and promised his company could strengthen the privacy protections of the database, Rogers and Olsen decided to cash out. The details of the deal have not been made publicly available. </p>
<p>Once again, genealogical information collected for and by genealogists has been sold. It’s happened time and again in the genealogy industry and each time genealogists react with surprise and dismay. But then they acquiesce, often then paying for access to their own donated data. </p>
<p>Reactions have run the gambit this time as well. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/dna-tests-make-fun-holiday-gifts-but-beware-of-the-hype-127607">DNA tests make fun holiday gifts, but beware of the hype</a>
</strong>
</em>
</p>
<hr>
<p>Some users immediately deleted their accounts. Others have declared their criminal relations better watch out. </p>
<p>Verogen’s Williams is hoping that his message will prevail. In a recent phone call, he said: “Public safety and public privacy are not mutually exclusive.”</p>
<p>Fighting rumours that the database would now be even more accessible to law enforcement, Rogers sent a reassuring to GEDmatch subscribers: “Verogen recognizes that law enforcement use of genetic genealogy is here to stay and is in a better position to prevent abuses and protect privacy than GEDmatch ever could have done on its own.” </p>
<p>William’s plan is to enhance the database to attract more civic-minded genealogists with advanced data analysis and a social media opt-in campaign. At the same time, Verogen is committed to fighting warrants and to restricting the amount of sensitive information that police can access, such as disease markers. </p>
<p>Williams is hoping that with his ethical stewardship, GEDmatch will preserve its original purpose while allowing Verogen to offer a seamless service to law enforcement. The database will still be public, but Verogan says it will now know how best to mine it. </p>
<p>As with all social media sites, genealogists and their family trees have become the product. Perhaps there are better ways to foster family this year than to gift away your genetic relatives, as criminal as you think they might be.</p>
<p><em>This is a corrected version of an article originally published on Dec. 22, 2019. The earlier story said the warrant for data was obtained by the FBI instead of the Orlando Police Department.</em></p>
<p>[ <em><a href="https://theconversation.com/ca/newsletters?utm_source=TCCA&utm_medium=inline-link&utm_campaign=newsletter-text&utm_content=expertise">Expertise in your inbox. Sign up for The Conversation’s newsletter and get a digest of academic takes on today’s news, every day.</a></em> ]</p><img src="https://counter.theconversation.com/content/128674/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Julia Creet receives funding from the Social Sciences and Humanities Council of Canada and the Office of the Privacy Commissioner of Canada.</span></em></p>Can the new owner of GEDmatch ,a genealogy database preserve its original purpose while allowing a seamless service to law enforcement?Julia Creet, Professor of English, York University, CanadaLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1265222019-11-25T19:09:43Z2019-11-25T19:09:43Z‘Gay gene’ testing apps aren’t just misleading – they’re dangerous<figure><img src="https://images.theconversation.com/files/303383/original/file-20191125-74542-ncnb0u.jpg?ixlib=rb-1.1.0&rect=39%2C0%2C8635%2C5774&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">No, a DNA swab can't tell you if you're gay, or likely to be obese, or depressed. And it can be damaging to believe so.</span> <span class="attribution"><span class="source">Shutterstock</span></span></figcaption></figure><p>The launch of a genetic app titled “How gay are you?” prompted a well-deserved outcry from scientists and the public last month, with media coverage branding it “<a href="https://thenextweb.com/apps/2019/10/15/disgusting-dna-app-falsely-claims-it-can-tell-how-gay-you-are/">disgusting</a>” and “<a href="http://inmagazine.ca/2019/10/the-latest-bad-idea-an-app-that-tells-you-how-gay-you-are/">the latest bad idea</a>”.</p>
<p>The app, which has since been withdrawn from sale, was just one of many available from online app store <a href="https://www.geneplaza.com/">GenePlaza</a>. Billing itself as “a marketplace for genetic reports”, this site offers a wide range of genetic tests that promise to reveal unassailable truths about your sleep, health, neuroses, ancestors, and even your intellect.</p>
<p>The genes tested in each “genetic app” are sourced from scientific reports that have established links between particular genetic variants and particular traits. But the tests are not directly affiliated with the scientists or their studies, and the interpretation and communication of the data produced by the apps is done solely by the developers.</p>
<h2>The science behind the test</h2>
<p>“How gay are you?” used data from a <a href="https://science.sciencemag.org/content/365/6456/eaat7693">paper</a> published earlier this year in the prestigious journal Science, showing that sexual orientation has a significant genetic component. According to the research, 8-25% of same-sex sexual behaviours can be accounted for by leafing through a few specific pages of the (very) lengthy book that represents your personal genome. </p>
<p>Sexual orientation is complex – thought to be the product of many genes, as well as environmental effects. Although certain gene variants are weakly related to same-sex attraction, the authors of this paper took pains to point out that <a href="https://theconversation.com/gay-gene-search-reveals-not-one-but-many-and-no-way-to-predict-sexuality-122459">genetics cannot be used to predict sexual orientation</a>.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/gay-gene-search-reveals-not-one-but-many-and-no-way-to-predict-sexuality-122459">'Gay gene' search reveals not one but many – and no way to predict sexuality</a>
</strong>
</em>
</p>
<hr>
<p>So what use is a genetic test if it can’t predict individual differences? Not much, most scientists think. </p>
<p>Benjamin Neale, an author on the paper from which the genetic data was derived, <a href="https://www.nature.com/articles/d41586-019-03282-0">sent a letter to GenePlaza</a> asking it to take down the app. A <a href="https://www.change.org/p/geneplaza-remove-dtc-genetic-test-how-gay-are-you-from-geneplaza-marketplace">change.org petition</a> to remove the test has attracted around 1,700 signatures. “How gay are you?” now appears on GenePlaza under the name “122 shades of gray”, is no longer available for purchase, and carries a disclaimer stating that it does not predict same-sex attraction and is not associated with the authors of the Science study.</p>
<h2>Genetic explanation and sexuality</h2>
<p>These tests are not just useless, but potentially dangerous. Information about the genetic basis of traits can have profound effects on the way we understand ourselves and others. </p>
<p>For sexual orientation, the impacts of genetic information seem mixed. One <a href="https://www.tandfonline.com/doi/abs/10.1080/00926239908403984?casa_token=mjjX9WP3DLsAAAAA:6kHKKqENqgyuFp1_0RXc5waO3X9btJWZt1d3oxkILB0QM4mIQQfP3n9N4LjcKkrCSE99k95u6rPOIJM">study</a> reported that learning about a biological basis for homosexuality increased anti-gay attitudes, whereas another <a href="https://journals.sagepub.com/doi/abs/10.2466/pr0.1992.71.3f.1219?casa_token=j_JOMB4AkPQAAAAA%3ARIngsyn8OvsDeSQNk8oxkQT4iCH8jrnL7_S3UMAiAEFrx6oPQkNYgPIeD50Yha0KUnKAVn7zhxVfEXI&">found the opposite</a>. </p>
<p>Although many people who identify as homosexual <a href="https://10daily.com.au/views/a190901gmcqu/the-no-gay-gene-study-terrifies-me-20190902">endorse a genetically determined view</a>, among sexual minorities this belief seems to be a double-edged sword. Gay men who perceive their sexuality as biological are <a href="https://psycnet.apa.org/record/2015-18254-001">more certain about their sexual identity, but also view themselves as more different from heterosexuals and in turn experience more self-stigma</a>. </p>
<p>For heterosexual and LGBT populations alike, more research is needed to know what psychological effects the results of genetic tests of this kind might have. </p>
<h2>Self-fulfilling prophecy</h2>
<p>For some other traits, it is already clear that belief in a genetic basis has a negative effect. Women given biological explanations of gender differences are more likely to hold <a href="https://www.tandfonline.com/doi/full/10.1080/15298860600980185?casa_token=x2mSzl4hF1kAAAAA%3AI_OrRWHHLs1xHF4gYsL6x_BP_lez4y3M5KeH4S11xO8_p40xN7Fmx2dAIbUn2TyOWMXEqhNo34OMtqE">negative self-stereotypes</a>. In one study, women who were informed that women have genetically inferior mathematical ability went on to <a href="https://science.sciencemag.org/content/314/5798/435">perform relatively poorly on a maths test</a>. </p>
<p>This suggests that even if there is no genetic basis for a behaviour or ability, receiving a genetic explanation can become a self-fulfilling prophecy. GenePlaza itself offers a <a href="https://www.geneplaza.com/app-store/70/preview">Math Ability</a> app, which promises to tell you how you stack up against the rest of humanity.</p>
<p>Obesity has also been shown to be affected by how we think about genes. Even the most common gene variant associated with obesity only explains a <a href="https://link.springer.com/article/10.1007/s13679-015-0143-1">tiny fraction</a> of the variability between individuals. Despite this, a whole cottage industry has sprouted to offer “genetically tailored” diets. </p>
<p>Not surprisingly, GenePlaza offers a <a href="https://www.geneplaza.com/app-store/53/preview">My Weight</a> app, with the tagline “can genes determine the size of your jeans?” The answer is possibly yes, albeit via your brain. </p>
<p>Learning that obesity has a genetic basis leads people to <a href="https://www.sciencedirect.com/science/article/abs/pii/S0195666317309807">discount the importance of exercise and a healthy diet</a>. In <a href="https://www.sciencedirect.com/science/article/abs/pii/S0195666314003572">one study</a>, participants given information about a link between genes and obesity ate more cookies than those who read a non-genetic explanation. </p>
<p>Perhaps most concerning is GenePlaza’s <a href="https://www.geneplaza.com/app-store/68/preview">Depression App</a>, which uses data from a <a href="https://www.nature.com/articles/s41588-018-0090-3?_ga=2.222013656.112907065.1541203200-2059058911.1541203200">2018 Australian study</a> to provide information about one’s genetic risk of depression (although it does feature a disclaimer that its results are “not a diagnosis, a prediction, or a predisposition score”). </p>
<p>Social psychologists have shown that when people are told they have a predisposition to depression they are <a href="https://link.springer.com/article/10.1007/s10897-017-0140-5">less confident in their ability to cope</a>, and even <a href="https://psycnet.apa.org/record/2017-48283-003">remember more depressive episodes</a> in their recent past.</p>
<p>Belief in a genetic basis to mental illness not only affects our self-perception, but our attitudes to others too. When thought to be genetically based, people are <a href="https://journals.sagepub.com/doi/abs/10.1177/002076409904500309?casa_token=9SDeL934DNsAAAAA:zcxwDIUuYtgvD3KcCjcX37bss5UT6SLo-EXnkfK28mdsD0mTK2Ume28X3UAuwiLnYvqiZr7idWy-3g">more negative</a> towards those with a mental illness and more likely to <a href="https://www.sciencedirect.com/science/article/abs/pii/S0277953613004164">perceive them as dangerous</a>. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/gene-testing-for-the-public-a-way-to-ward-off-disease-or-a-useless-worry-79757">Gene testing for the public: a way to ward off disease, or a useless worry?</a>
</strong>
</em>
</p>
<hr>
<p>These apps are marketed as a curiosity or as harmless fun. But there is danger in claiming to be able to use genetics to predict any aspect of someone’s identity, abilities, mental health or sexual orientation. Misunderstanding of genetic information can have grave consequences for those receiving it.</p><img src="https://counter.theconversation.com/content/126522/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Kate Lynch receives funding from The John Templeton Foundation and the Australian Research Council. </span></em></p><p class="fine-print"><em><span>Ilan Dar-Nimrod receives/received funding from the Australian Research Council and The John Templeton Foundation. </span></em></p><p class="fine-print"><em><span>James Morandini receives funding from The John Templeton Foundation</span></em></p>Genetic apps claim to reveal fundamental insights about your health, well-being, and even intellect. But it’s not just spurious science - believing these traits are genetic can have harmful consequences.Kate Lynch, Postdoctoral Research Fellow, University of SydneyIlan Dar-Nimrod, Senior lecturer, University of SydneyJames Morandini, Postdoctoral fellow, University of SydneyLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1266802019-11-12T21:17:53Z2019-11-12T21:17:53ZIf you’ve given your DNA to a DNA database, US police may now have access to it<figure><img src="https://images.theconversation.com/files/301191/original/file-20191112-178511-1bnej52.jpg?ixlib=rb-1.1.0&rect=5%2C0%2C1791%2C1193&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">DNA database giant Ancestry lets members access international records including the convict and free settler lists, passenger lists, Australian and New Zealand electoral rolls and military records.</span> <span class="attribution"><a class="source" href="https://www.flickr.com/photos/aspidoscelis/4461828038/">Patrick Alexander/Flickr</a>, <a class="license" href="http://creativecommons.org/licenses/by/4.0/">CC BY</a></span></figcaption></figure><p>In the past week, <a href="https://www.thetelegraph.com/news/article/Florida-judge-grants-police-warrant-to-access-14823041.php">news has spread</a> of a Florida judge’s decision to grant a warrant allowing police to search one of the world’s largest online DNA databases, for leads in a criminal case.</p>
<p>The warrant reportedly approved the search of <a href="https://opensource.com/resources/what-open-source">open source</a> genealogy database <a href="https://www.gedmatch.com/login1.php">GEDMatch</a>. An estimated 1.3 million users have uploaded their DNA data onto it, without knowing it would be accessible by law enforcement. </p>
<p>A decision of this kind raises concern and sets a new precedent for law enforcement’s access to online DNA databases. Should Australian users of online genealogy services be concerned? </p>
<h2>Why is this a big deal?</h2>
<p>GEDmatch lets users upload their raw genetic data, obtained from companies such as Ancestry or 23andMe, to be matched with relatives who have also uploaded their data. </p>
<p>Law enforcement’s capacity to use GEDmatch to solve crimes became prominent in April last year, when it was used to solve the <a href="https://www.nytimes.com/2018/04/26/us/golden-state-killer.html">Golden State Killer case</a>. After this raised significant public concern around privacy issues, GEDmatch <a href="https://www.forensicmag.com/news/2019/05/gedmatch-changes-blow-law-enforcement-and-forensic-genealogy?cmpid=horizontalcontent">updated its terms and conditions in May</a>. </p>
<p>Under the new terms, law enforcement agencies can only access user data in cases where users have consented to use by law enforcement, with <a href="https://www.nytimes.com/2019/11/05/business/dna-database-search-warrant.html">only 185,000 people opting in so far</a>.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/no-mr-dutton-dna-testing-isis-brides-wont-tell-you-whos-an-australian-citizen-125712">No, Mr Dutton, DNA testing ISIS brides won't tell you who's an Australian citizen</a>
</strong>
</em>
</p>
<hr>
<p>The terms of the warrant granted in Florida, however, allowed access to the full database - including individuals who had not opted in. This directly overrides explicit user consent. </p>
<p>GEDmatch reportedly complied with the search warrant within 24 hours of it being granted. </p>
<h2>Aussies are also at risk</h2>
<p>GEDMatch is small fry compared with ancestry database giants Ancestry (<a href="https://www.ancestry.com/corporate/about-ancestry/company-facts">more than 15 million individuals</a>) and 23andMe (<a href="https://mediacenter.23andme.com/company/about-us/">more than 10 million individuals</a>), both of which have DNA data belonging to Australians.</p>
<p>Australians who wish to have ancestry DNA testing have to use US-based online companies. Thus, many Australians have data in databases such as Ancestry, 23andMe and GEDMatch. The granting of a warrant to search these databases by US courts means those searches could include Australian individuals’ data.</p>
<p><a href="https://www.ancestry.com.au/cs/legal/lawenforcement">Ancestry</a> and <a href="https://www.23andme.com/en-int/law-enforcement-guide/">23andMe</a> both have policies saying they don’t provide access to their databases without valid court-mandated processes. </p>
<p>Each company produces a transparency report (see <a href="https://www.ancestry.com.au/cs/transparency">here</a> and <a href="https://www.23andme.com/en-int/transparency-report/">here</a>) which includes all requests for customer data that have been received and complied with. Currently, that number is low. But it remains to be seen how each would respond to a court-ordered search warrant.</p>
<p>Furthermore, while Australia currently doesn’t have it’s own genetic database (and no plans have been announced), the federal government’s commitment <a href="https://www.health.gov.au/ministers/the-hon-greg-hunt-mp/media/genomics-health-futures-mission-expert-advisory-committee-appointed">of A$500 million to the Genomics Health Futures Mission</a> indicates a growing interest in the power of genomics for health. </p>
<p>If Australia wants to remain internationally competitive, a national genetics project is a natural next step.</p>
<h2>We need DNA privacy legislation</h2>
<p>In Australia, courts can approve warrants that intrude into private information, and entities can only protect data to the extent that it’s protected by law.</p>
<p>Thus, the privacy policies of companies and organisations that hold genetic data (and other types of private data) usually include a statement saying the data will not be shared without consent “except as required by law”. </p>
<p>The Australian Information Commissioner can also <a href="https://www.oaic.gov.au/privacy/privacy-registers/public-interest-determinations-register/public-interest-determinations/">allow breaches of privacy in the public interest</a>.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/what-does-dna-sound-like-using-music-to-unlock-the-secrets-of-genetic-code-78767">What does DNA sound like? Using music to unlock the secrets of genetic code</a>
</strong>
</em>
</p>
<hr>
<p>It has been more than two decades since Senator Natasha Stott-Despoja proposed the <a href="https://www.aph.gov.au/Parliamentary_Business/Bills_Legislation/Bills_Search_Results/Result?bId=s156">Genetic Privacy and Non-Discrimination Bill</a>. </p>
<p>Although Australia has a patchwork of laws that protect citizens’ genetic data to an extent, we still have no specific genetic data protection legislation. A broader legal framework dealing directly with the protection of genetic information is now required. </p>
<p>Australian politicians have previously <a href="https://www.smh.com.au/politics/nsw/everybody-hates-a-welfare-rorter-latham-spruiks-dna-testing-plan-for-aboriginal-people-20190311-p513au.html">shown willingness to use genetic information for government purposes</a>. As genetic advances strengthen the promise of personalised medicine, Australian academics continue to <a href="https://www.itnews.com.au/news/get-a-warrant---fresh-dna-data-protection-demands-from-university-of-queensland-517046">call for urgent genetic data protection legislation</a>. This is important to ensure public trust in genetic privacy is maintained. </p>
<p>Ongoing concerns around <a href="https://theconversation.com/australians-can-be-denied-life-insurance-based-on-genetic-test-results-and-there-is-little-protection-81335">genetic discrimination</a>, and <a href="https://www.smh.com.au/national/the-troubling-implications-of-my-health-record-s-genetic-info-plans-20180807-p4zvz1.html">other ethical concerns</a>, warrant an urgent policy response regarding the protection of genetic data.</p>
<h2>What are other countries doing?</h2>
<p>Globally, <a href="https://isogg.org/wiki/Autosomal_DNA_testing_comparison_chart">several DNA databases</a> have amassed genetic datasets of more than 1 million individuals, including for research purposes and healthcare improvement. </p>
<p>Few databases outside the US have yet to reach the numbers needed to be <a href="https://www.wired.com/story/genome-hackers-show-no-ones-dna-is-anonymous-anymore/">useful for identification purposes</a>. </p>
<p>However, many countries, particularly in Europe, have started establishing government-funded national databases of gene donor data, including <a href="https://biobanksverige.se/english/research/getting-started/about-biobank-sweden/">Sweden</a> and <a href="https://genomics.ut.ee/en/about-us/estonian-genome-centre">Estonia</a>.</p>
<p>The Estonian Biobank is one of the <a href="https://www.forbes.com/sites/yiannismouratidis/2019/01/30/estonia-houses-the-biggest-biobank-in-europe/#7aa76207227a">most advanced national DNA databases</a>. It has <a href="https://genomics.ut.ee/en/news/estonian-researchers-strive-personalise-healthcare">more than 200,000 donor samples</a>. </p>
<p>With a population of around 1.3 million people, the biobank represents around 15% of the entire country’s population. And <a href="https://www.riigiteataja.ee/en/eli/ee/508042019001/consolide">Estonian legislation</a> currently prohibits the use of donor samples for law enforcement.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/from-the-crime-scene-to-the-courtroom-the-journey-of-a-dna-sample-82250">From the crime scene to the courtroom: the journey of a DNA sample</a>
</strong>
</em>
</p>
<hr>
<p>In contrast, the <a href="https://www.ukbiobank.ac.uk/about-biobank-uk/">UK Biobank,</a> doesn’t have specific legislation controlling its operation. It only allows law enforcement agencies access <a href="https://www.ukbiobank.ac.uk/all-faqs/">if forced to do so by the courts</a>, leaving open the possibility of access under a court-ordered warrant. </p>
<p>The biobank currently has samples from <a href="https://www.nature.com/collections/bpthhnywqk">around 500,000 individuals</a>, but plans to collect <a href="https://www.bionews.org.uk/page_138891">at least 1 million more</a> in future. </p>
<p>In Australia, accessing DNA testing is now easier than ever. But those accessing it through US-based companies, or uploading their data to US-based databases, should be aware of the potential uses of their genetic information.</p>
<p>And as we moves into an era of genomic medicine, urgent policy attention is required from the Australian government to ensure public trust in genomics is maintained.</p><img src="https://counter.theconversation.com/content/126680/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Jane Tiller does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>A US judge has allowed police access to the major DNA database without users’ consent (including Australian users). It’s a timely reminder that we urgently need genetic privacy legislation.Jane Tiller, Ethical, Legal & Social Adviser - Public Health Genomics, Monash UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1257122019-10-24T19:02:08Z2019-10-24T19:02:08ZNo, Mr Dutton, DNA testing ISIS brides won’t tell you who’s an Australian citizen<p>Home affairs minister Peter Dutton <a href="https://www.sbs.com.au/news/peter-dutton-says-is-brides-need-dna-testing-to-prove-australian-citizenship">suggested</a> earlier this week that DNA testing would be needed to verify Australian citizenship claims of ISIS brides trapped in Syria.</p>
<blockquote>
<p>There are some people who may claim to be Australian citizens — we don’t know whether they are […] You would need DNA testing and you’d need other checks to be made.</p>
</blockquote>
<p>But no DNA testing is going to determine if a person is a citizen. DNA testing can, in theory and in specific circumstances, determine who is related to whom. Yet, there would be so many legal and practical barriers to carrying it out under these circumstances, it’s unlikely Mr Dutton’s proposal would ever get off the ground.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/explainer-isis-isil-islamic-state-or-daesh-40838">Explainer: ISIS, ISIL, Islamic State or Da'esh?</a>
</strong>
</em>
</p>
<hr>
<h2>What type of DNA testing is relevant here?</h2>
<p>While we don’t know the specifics, Mr Dutton is likely suggesting so-called ISIS brides have their DNA tested to determine parentage or who is closely related to them.</p>
<p>The most common technique is short tandem repeat or <a href="https://strbase.nist.gov//images/STRBase.pdf">STR testing</a>. This looks at parts of a person’s DNA, half of which is inherited from the mother, the other half from the father, at the moment that person was conceived. This DNA varies between people and is found in the nucleus of almost every cell in your body.</p>
<p>Broadly speaking, the more closely two people are related, the more of their STRs they share in common.</p>
<p><div data-react-class="Tweet" data-react-props="{"tweetId":"1186870450866909184"}"></div></p>
<p>But STR tests are of limited value in determining distant family relationships; every “degree of separation” between two people reduces the amount of DNA they have in common by half.</p>
<p>So, in this case, it would be difficult to see how STR testing would give any useful information to connect someone in Syria with relatives much beyond siblings or parents in Australia. For example, two cousins may only have between one 16th and one quarter of their STRs in common, which is far from a convincing “match”.</p>
<p>Sometimes a lab may decide to look at someone’s mitochondrial DNA, or mtDNA, instead. This is only inherited from someone’s mother. This method is nowhere near as discriminating as STR testing, but can help identify maternal relatives.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/more-than-a-hunch-identifying-richard-iii-with-dna-11999">More than a hunch: identifying Richard III with DNA</a>
</strong>
</em>
</p>
<hr>
<h2>Who can perform this DNA testing?</h2>
<p>In Australia, the scope of DNA testing in criminal investigations is tightly controlled by <a href="http://www6.austlii.edu.au/cgi-bin/viewdb/au/legis/nsw/consol_act/cpa2000277/">state</a> and <a href="https://www.legislation.gov.au/Details/C2004C01319">commonwealth legislation</a>. Only STRs from certain convicted criminals can be stored on a database; other DNA samples (from victims, acquitted people) cannot be retained; and there are limitations on the covert collection of samples.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/from-the-crime-scene-to-the-courtroom-the-journey-of-a-dna-sample-82250">From the crime scene to the courtroom: the journey of a DNA sample</a>
</strong>
</em>
</p>
<hr>
<p>In civil matters, laboratories cannot test samples not provided voluntarily, unless under a court order. DNA information from these tests cannot be shared with police.</p>
<p>In both civil and criminal investigations, the collection of DNA samples (usually saliva or cheek cells) is strictly controlled by legislation to ensure the integrity of the sample.</p>
<h2>So, what does this mean for Mr Dutton’s suggestion?</h2>
<p>The following constraints make it difficult to envisage how Mr Dutton’s proposal could be implemented:</p>
<ul>
<li><p>samples from the so-called ISIS brides in the Middle East would need to be collected by authorised personnel. But this government is resisting sending officials to that region for <a href="https://www.sbs.com.au/news/peter-dutton-says-is-brides-need-dna-testing-to-prove-australian-citizenship">safety reasons</a></p></li>
<li><p>extensive paperwork would need to be designed, or modified from existing forms, to ensure the integrity of the samples and confirm the identity of the donor</p></li>
<li><p>samples would need to be quickly and securely transported to Australia</p></li>
<li><p>DNA samples are only useful if you have something to compare it to. How many (if any) of the “IS brides” have their DNA on a criminal database in Australia? </p></li>
<li><p>if there was no DNA in a criminal database, then close relatives (for instance parents, known siblings) would also need DNA testing. STR testing in these circumstances would provide valuable information of the relationship. However, legally these relatives cannot be compelled to cooperate, unless by court order. Which court would order them to do so, under what legislation?</p></li>
<li><p>mtDNA testing might be of little value when large family groups are involved, for instance when testing large family groups either held in the Middle East or when comparing with large family groups in Australia</p></li>
<li><p>who will do this testing? Will the burden be placed on the already overworked state or federal government labs, or will private labs do the work?</p></li>
</ul>
<h2>How will this help?</h2>
<p>Even if we were to overcome all these considerable hurdles, what then? How will a DNA test help repatriate the “right” ISIS brides and their families?</p>
<p>No DNA test is going to determine whether a person is a citizen or not. Australia does not collect DNA samples (or fingerprints) from its citizens, be they naturalised or born here. So what’s the point?</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/how-women-wage-war-a-short-history-of-is-brides-nazi-guards-and-farc-insurgents-113011">How women wage war – a short history of IS brides, Nazi guards and FARC insurgents</a>
</strong>
</em>
</p>
<hr>
<img src="https://counter.theconversation.com/content/125712/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Peter Gunn does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>DNA testing gives limited information about whether people are likely to be related. But even if we overcame the many practical and legal hurdles to implementing it, what’s the point?Peter Gunn, Honorary Associate Professor, Forensic Biology, University of Technology SydneyLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1206642019-08-21T19:54:02Z2019-08-21T19:54:02ZShould I get my DNA tested? We asked five experts<figure><img src="https://images.theconversation.com/files/285222/original/file-20190723-11350-1ud463r.jpg?ixlib=rb-1.1.0&rect=0%2C2%2C1000%2C651&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">Is it worthwhile to know you're 25% Irish? </span> <span class="attribution"><span class="source">from www.shutterstock.com</span></span></figcaption></figure><p>With the advent of online ancestry DNA testing, and advancements in genetic screening for various medical aliments, we’re able to know more than ever about the genes that make us who we are. </p>
<p>But is there a point to knowing we’re 25% Irish? And is there a point to knowing we could one day be struck down with a disease we’re unable to prevent? </p>
<p>We asked five experts if we should consider a DNA test.</p>
<h2>Four out of five experts said yes</h2>
<figure class="align-center ">
<img alt="" src="https://images.theconversation.com/files/259889/original/file-20190220-148520-121cdzg.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/259889/original/file-20190220-148520-121cdzg.png?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=99&fit=crop&dpr=1 600w, https://images.theconversation.com/files/259889/original/file-20190220-148520-121cdzg.png?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=99&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/259889/original/file-20190220-148520-121cdzg.png?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=99&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/259889/original/file-20190220-148520-121cdzg.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=125&fit=crop&dpr=1 754w, https://images.theconversation.com/files/259889/original/file-20190220-148520-121cdzg.png?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=125&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/259889/original/file-20190220-148520-121cdzg.png?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=125&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption"></span>
</figcaption>
</figure>
<p><strong><em>Here are their detailed responses:</em></strong></p>
<p><iframe id="tc-infographic-427" class="tc-infographic" height="400px" src="https://cdn.theconversation.com/infographics/427/45901c723a843d0a712aa7bdf2ed8f27399293a3/site/index.html" width="100%" style="border: none" frameborder="0"></iframe></p>
<hr>
<p><em>If you have a “<strong>yes or no</strong>” health question you’d like posed to Five Experts, email your suggestion to: alexandra.hansen@theconversation.edu.au</em></p>
<hr>
<figure class="align-center ">
<img alt="" src="https://images.theconversation.com/files/210303/original/file-20180314-113452-h7un11.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/210303/original/file-20180314-113452-h7un11.png?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=399&fit=crop&dpr=1 600w, https://images.theconversation.com/files/210303/original/file-20180314-113452-h7un11.png?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=399&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/210303/original/file-20180314-113452-h7un11.png?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=399&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/210303/original/file-20180314-113452-h7un11.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=501&fit=crop&dpr=1 754w, https://images.theconversation.com/files/210303/original/file-20180314-113452-h7un11.png?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=501&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/210303/original/file-20180314-113452-h7un11.png?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=501&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption"></span>
</figcaption>
</figure>
<p><em>None of the authors have any interests or affiliations to declare.</em></p><img src="https://counter.theconversation.com/content/120664/count.gif" alt="The Conversation" width="1" height="1" />
We asked five experts if DNA testing was worthwhile. Four out of five said yes.Alexandra Hansen, Deputy Editor and Chief of Staff, The Conversation AUNZLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1192312019-07-01T19:40:25Z2019-07-01T19:40:25ZGenetic risk tests are now widely available, but they aren’t always useful – and could even be harmful<figure><img src="https://images.theconversation.com/files/281939/original/file-20190701-105168-zpvq3c.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">Polygenic risk scores currently account for only a small proportion of your total genetic risk.</span> <span class="attribution"><a class="source" href="https://www.shutterstock.com/image-illustration/digital-blue-dna-texture-innovation-medicine-750726223?src=TzhHsrLnu3qElvHEQANGqA-1-22&studio=1">Shutterstock</a></span></figcaption></figure><p>Genetic testing used to be something that happened in a specialist clinic for those few families that had serious inherited conditions, like <a href="https://en.wikipedia.org/wiki/Huntington's_disease#Predictive_genetic_testing">Huntington’s Disease</a> or rare cancers. </p>
<p>Now, new genetic tests called “polygenic risk scores” have increased access to genetic risk information for a wide range of conditions. With a few clicks of a mouse and a few hundred dollars, anyone can access their or their genetic risk scores for diabetes, obesity, breast cancer, autism, and schizophrenia. </p>
<p>These scores aren’t always useful, and, in some cases, they could be harmful.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/explainer-what-is-genetic-risk-25969">Explainer: what is genetic risk?</a>
</strong>
</em>
</p>
<hr>
<h2>Results can be misleading</h2>
<p>Previous approaches to genetic testing looked at just one gene for which particular mutations are known to cause a disease. The newer technology of polygenic risk scores are calculated from hundreds, if not thousands, of genetic markers measured from your DNA at many points on the genome. These measurements are fed into a formula, based on studying people who do or do not have a condition, to produce a “personalised” genetic risk score. </p>
<p>While researchers are looking at how these tests might be used by doctors to <a href="https://care.diabetesjournals.org/content/42/2/200">predict type 1 diabetes in newborns</a>, or <a href="https://doi.org/10.1371%2Fjournal.pmed.1002546">prescribe the right medications</a> for people with heart disease, companies like <a href="https://www.technologyreview.com/s/613095/23andme-thinks-polygenic-risk-scores-are-ready-for-the-masses-but-experts-arent-so-sure/">23andme are forging ahead</a> with products that offer polygenic risk scores for diabetes and other conditions to their customer base of <a href="https://thednageek.com/23andme-has-more-than-10-million-customers/">over 10 million</a>. As these are classified as “<a href="https://www.fda.gov/regulatory-information/search-fda-guidance-documents/general-wellness-policy-low-risk-devices?source=govdelivery&utm_medium=email&utm_source=govdelivery">general wellness</a>” products by US regulators, they can be provided without medical support. </p>
<p>Before we jump wholeheartedly into the new world of genetic health and medicine, it’s important to consider the implications for patients and clinicians, and especially for consumers outside the clinic. Even if risk scores incorporate information from many different genes, there are two things they currently miss. </p>
<p>First, polygenic risk scores currently account for only a small proportion of a person’s total genetic risk. Second, environmental risk factors are also important, and likely multiply the risks associated with genetic factors. A genetic risk score alone can give a misleading picture of your actual disease risk. </p>
<h2>They can be inaccurate</h2>
<p>There are questions about the <a href="https://www.nature.com/articles/s41436-018-0418-5">accuracy of the genetic scores</a>. Scores are calculated using past research into genetic associations with a particular condition. That is, the gene variants that are more commonly seen in people with the disease. </p>
<p>But knowing what gene variants are more common in people with a disease is different to knowing what gene variants will predict that someone without the disease will get it later in life. While more research is needed to develop genetic tests that are useful for predicting complex chronic diseases, some companies are forging ahead with genetic risk products of doubtful accuracy.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/can-a-genetic-test-predict-if-you-will-develop-type-2-diabetes-113343">Can a genetic test predict if you will develop Type 2 diabetes?</a>
</strong>
</em>
</p>
<hr>
<p>Companies marketing genetic risk scores might use their <a href="https://www.mdpi.com/2073-4425/10/6/448?type=check_update&version=1">own specific formula</a> drawing on different published data to generate the risk predictions they return to their consumers. This means that one person could submit their samples to multiple companies and have different – and sometimes conflicting – results returned to them. </p>
<p>Some consumers of genetic ancestry tests know this well, as results from the same company drastically change when they <a href="https://www.smh.com.au/national/time-to-get-that-viking-tattoo-removed-ancestry-updates-dna-results-20190426-p51hmh.html">update their formulas</a>. </p>
<p>In rare cases, the results of genetic testing can be plain wrong, with distressing consequences. One woman had her breasts surgically removed to reduce her risk of breast cancer after receiving a genetic test result that <a href="https://www.huffpost.com/entry/brca-genetic-testing-mastectomy_n_5c6c39fbe4b012225acd80d3">turned out to be incorrect</a>. </p>
<p>In addition, the <a href="https://www.nature.com/articles/gim2014169">jury is still out</a> on whether knowing you are at an increased genetic risk for something will lead to a decrease in your risk of developing the condition. There is evidence from <a href="https://www.ncbi.nlm.nih.gov/pubmed/28785835">research on depression</a>, for example, that suggests knowing you are genetically at risk may hinder rather than help recovery. </p>
<h2>Testing could increase health disparities</h2>
<p>Even if the predictive power of a particular genetic risk score is beyond doubt, it may only be accurate for a minority of the population who have only European ancestors. </p>
<p>About 80% of the data used to derive the scores have come from studies of people of <a href="https://www.nature.com/articles/s41588-019-0394-y">European descent</a> (who account for only 16% of the world’s population). </p>
<p>So these scores might be less accurate for people from other backgrounds. If these new tools are applied to improve health for people of European ancestry, they could actually <a href="https://www.nature.com/articles/s41588-019-0379-x">increase health disparities</a>. </p>
<h2>The ethics of ‘designer babies’</h2>
<p>All these issues are compounded if the person buying the test is a prospective parent seeking to select an embryo for implantation. </p>
<p>Within the clinical setting, pre-implantation genetic testing – used in tandem with IVF – can help parents who want to ensure their future child does not develop a serious genetic disease that runs in their family. But some companies are now offering to calculate polygenic risk scores that allow prospective parents to <a href="https://www.genengnews.com/insights/polygenic-risk-scores-and-genomic-prediction-qa-with-steven-hsu/">select embryos</a> that have a lower risk score for diabetes, heart disease, cancer, short stature or low intelligence irrespective of the family history. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/your-genes-can-help-predict-how-well-youll-do-in-school-heres-how-we-cracked-it-62848">Your genes can help predict how well you'll do in school – here's how we cracked it</a>
</strong>
</em>
</p>
<hr>
<p>These products raise serious and wide-ranging <a href="http://ewanbirney.com/2019/05/why-embryo-selection-for-polygenic-traits-is-wrong.html">scientific and ethical</a> concerns. Researchers have questioned whether selecting embryos on the basis of these tests will actually <a href="https://www.biorxiv.org/content/10.1101/626846v1">produce the outcomes parents might expect</a>. Others have raised broader concerns about the long term effects of <a href="https://www.technologyreview.com/s/612258/are-we-designing-inequality-into-our-genes/">embedding inequities in our genes</a>. </p>
<p>National agencies that regulate the use of these emerging technologies will need to tread carefully when considering how polygenic risk scores could be used in embryo selection. </p>
<p>For now, more research is required to improve the accuracy of polygenic risk scores, to assess their appropriate use outside of the clinical setting, and to work out how to best support consumers who may find themselves in an uncertain position. </p>
<hr>
<p><em>The authors will be discussing this issue at the <a href="https://www.eventbrite.com.au/e/emerging-issues-in-science-and-society-tickets-61910795857">Emerging Issues in Society and Society</a> symposium on July 2.</em></p><img src="https://counter.theconversation.com/content/119231/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Emma Kowal receives funding from the Australian Research Council and the National Health and Medical Research Council. She is on the Expert Advisory Committee of the Genomics Health Futures Mission. She leads the Deakin Science and Society Network and is a member of the Deakin University Gen(e)quality Research Network. The authors acknowledge the useful feedback received from John Hopper and Bob Williamson on this piece. </span></em></p><p class="fine-print"><em><span>Jacqueline Savard has received funding from the Inspiring Australia - Science Engagement Programme and the Australian Research Council.</span></em></p><p class="fine-print"><em><span>Jeffrey Craig receives funding from the National Health and Medical Research Council, the Australian Research Council, the Cerebral Palsy Alliance, and the Waterloo Foundation. He is President of the International Society for Twin Studies, and leads the Deakin University Gen(e)quality Research Network.</span></em></p>Most common chronic diseases are the outcome of complex interactions between genetic, environmental and social risk factors, so a genetic risk score, on its own, isn’t much help.Emma Kowal, Professor of Anthropology, Deakin UniversityJacqueline Savard, Lecturer in Health Ethics and Professionalism, Deakin UniversityJeffrey Craig, Associate Professor in Medical Sciences, Deakin UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1185662019-06-13T17:15:07Z2019-06-13T17:15:07ZWho’s your daddy? Don’t ask a DNA test<figure><img src="https://images.theconversation.com/files/279196/original/file-20190612-32335-l4jcax.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">What are the rules that make a man a father?</span> <span class="attribution"><a class="source" href="https://unsplash.com/photos/eFmLuPyzgxI">Slava Potik/Unsplash</a>, <a class="license" href="http://creativecommons.org/licenses/by/4.0/">CC BY</a></span></figcaption></figure><p>“<a href="https://nypost.com/2017/07/23/man-ordered-to-pay-65k-in-child-support-for-kid-who-isnt-his/">Man Ordered to Pay $65K</a> in Child Support for Kid Who Isn’t His.” “<a href="https://www.news4jax.com/news/investigations/father-hopes-to-change-state-paternity-law-after-losing-custody-of-daughter">Father Hopes to Change State Paternity Law</a>” after losing custody of his biological daughter to another man. The headlines are lurid and seemingly nonsensical. How can a man bear financial responsibility for a child that is not “his”? How can he be denied legal paternity of a child whom he conceived?</p>
<p>The gist of these stories is that such outcomes are not only ludicrous but unjust. Such tales not only appear in the mainstream media but provide fodder for <a href="https://mensrights.com/texas-child-support-paternity/">men’s rights websites</a> and <a href="https://www.nj.com/news/2012/03/nj_legislator_proposes_measure.html">have even inspired bills to</a> <a href="http://www2.ljworld.com/news/2011/feb/12/bill-kansas-house-would-require-paternity-testing-/">make DNA testing mandatory at birth</a>, though none has actually become law.</p>
<p>But <a href="http://www.hup.harvard.edu/catalog.php?isbn=9780674980686">history suggests</a> such cases are not so strange. In fact, they follow from a long tradition in which paternity was a social and legal relationship, not a biological one.</p>
<p>After all, it was only in the 1980s that DNA testing emerged, with its <a href="https://www.nytimes.com/1989/07/21/us/the-law-dna-test-dooms-paternity-trials-lawyers-say.html">promise to reveal the identity of the biological father</a>. For most of human history, no such technology existed – nor was it missed. Paternity was based on presumption, deduced from social behaviors and legal conventions.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/279198/original/file-20190612-32361-1gtbj17.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/279198/original/file-20190612-32361-1gtbj17.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/279198/original/file-20190612-32361-1gtbj17.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/279198/original/file-20190612-32361-1gtbj17.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/279198/original/file-20190612-32361-1gtbj17.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/279198/original/file-20190612-32361-1gtbj17.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/279198/original/file-20190612-32361-1gtbj17.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/279198/original/file-20190612-32361-1gtbj17.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Is a baby’s father set by social, legal, biogenetic factors… or a combination of all?</span>
<span class="attribution"><a class="source" href="https://unsplash.com/photos/Mx2f4psEnvU">Minnie Zhou/Unsplash</a>, <a class="license" href="http://creativecommons.org/licenses/by/4.0/">CC BY</a></span>
</figcaption>
</figure>
<h2>Father, by tradition</h2>
<p>Historically, the father was defined by marriage. Pater est quem nuptiae, in the Roman formulation: The father is he whom marriage indicates, even in circumstances when, well, he could not be. The tradition carried forward over the centuries. According to 17th-century English common law, for example, if a husband was located anywhere within the “Four Seas” of the King of England at the time of his wife’s conception, he was legally presumed the father of her child.</p>
<p>As for children born out of wedlock, courts, especially those operating in the civil law tradition, <a href="https://www.dukeupress.edu/children-of-fate">deduced paternity from a man’s actions or public reputation</a>. The father was he who cohabited with the mother or kissed the baby in public, the man whom a neighbor saw paying the wet nurse. Paternity was performative.</p>
<p>Such definitions of fatherhood did not mean it was less certain or less true: It was simply that the truth of paternity was social, not physical.</p>
<p>This situation contrasted with the logic of maternity. Mater certissima est – the mother is always certain, in the Roman formulation. Maternal identity could presumably be known by the physical facts of pregnancy and birth.</p>
<h2>A more muddled modern landscape</h2>
<p>Today, according to some observers, reproductive technologies like <a href="https://heinonline.org/HOL/LandingPage?handle=hein.journals/ylr96&div=17&id=&page=">surrogacy and egg donation have disrupted the certainty</a> of the Roman dictum on maternity. After all, maternal identity is not so obvious when the gestational mother who births the child and the genetic one whose egg creates it can be two different people.</p>
<p>By contrast, <a href="https://doi.org/10.1001/jama.1983.03340180090038">DNA was supposed to make biological paternity certain</a>. And yet the older reasoning that long defined paternity as a social relationship endures.</p>
<p>Today, family law in the U.S. and elsewhere continues to <a href="https://scholarship.law.cornell.edu/cjlpp/vol14/iss1/1/">recognize nonbiological lines of reasoning</a>. A man’s behavior, intent, the nature of his relationship with the mother, stability in a preexisting parent-child relationship – all these criteria, rather than biology, may define the father. If anything, reproductive technologies like sperm donation and new family forms, like those born of the frequency of divorce, have only multiplied the scenarios in which biology may take a backseat to social criteria.</p>
<p>But in some contexts, the biological continues to prevail. This is often the case in immigration and citizenship law. Kin relations play a central role in immigration proceedings in the U.S. and other countries because <a href="https://digitalcommons.law.yale.edu/ylj/vol120/iss4/5">citizens can sponsor close relatives to immigrate</a>, and under certain circumstances refugees have a <a href="https://scholarship.law.umassd.edu/umlr/vol8/iss2/4">right to join family members</a> in their adopted country.</p>
<p>Increasingly, countries that are migration destinations use DNA to verify family relationships. In May 2019, for instance, the U.S. Department of Homeland Security began a <a href="https://www.cnn.com/2019/04/30/politics/homeland-security-dna-testing-immigration/index.html">pilot program to test Central American migrant families</a> at the southern border.</p>
<p>As critics have noted, this practice <a href="https://www.washingtonpost.com/outlook/2019/05/13/rapid-dna-promises-identify-fake-families-border-it-wont/">imposes a narrow, biological definition of family</a>. Kinship practices like adoption, stepparenthood and relationships based on a social understanding of parentage are considered perfectly legitimate when practiced by natives but are vilified as fraudulent and criminal when practiced by foreigners.</p>
<p>These apparently contradictory definitions of parentage reflect the fact that paternity’s definition varies depending on whose parentage is at stake – and how much power they hold.</p>
<p>Law and custom have always purposefully obfuscated the fatherhood of certain categories of men: the slave owner, the priest, the colonizer, the soldier. <a href="https://www.upress.virginia.edu/title/2650">Thomas Jefferson’s paternity</a> of Sally Hemings’ children was publicly obscured for two centuries. In an entirely different historical context, <a href="https://press.princeton.edu/titles/8048.html">German women after World War II</a> found it impossible to bring paternity suits against American soldiers who had fathered their children.</p>
<p>The fact that some fathers, like Jefferson and the GIs, have remained strategically uncertain suggests the very notion of paternal uncertainty is not a biological axiom but a political idea.</p>
<h2>Life’s too complicated to rely on DNA</h2>
<p>Over the last century, the distinction between legitimate and illegitimate children has <a href="https://doi.org/10.2307/838374">lost much of its social and legal significance</a> in the West. The once markedly different criteria for proving maternity versus paternity have largely, though not entirely, disappeared. Under U.S. law, children born abroad to unmarried citizen fathers <a href="http://www.slate.com/articles/news_and_politics/jurisprudence/2010/11/sexing_citizenship.html">still do not enjoy the same rights to citizenship</a> as those born to citizen mothers, for example.</p>
<p>At the same time, stratification has been reinforced in other contexts, as in the contrasting definitions of parentage among citizens and foreigners. New dynamics of discrimination have also arisen as assisted reproductive technologies and same-sex couples produce new permutations of family.</p>
<p>Take the <a href="https://www.nytimes.com/2019/05/21/us/gay-couple-children-citizenship.html">recent conundrum</a> faced by two dads and their young daughter. Both men are U.S. citizens and are legally married; their daughter was born abroad to a surrogate. Drawing on a tortured combination of both biological considerations – the fact that child was not genetically related to both parents – and social ones – nonrecognition of the couple’s marriage – the State Department denied their child U.S. citizenship. What such a case shows is not that old laws have failed to keep pace with new family forms, but how the state can generate new forms of stratification even as older ones fade.</p>
<p>With the dawn of the DNA era, many observers predicted that, by revealing the truth of paternity, <a href="https://doi.org/10.1001/jama.1983.03340180090038">genetic science would one day abolish ambiguity</a> and deliver equality and justice. Today science can indeed find a father, but its impact has been rather more complex than once anticipated. Instead of sweeping away older social and legal definitions with a new biogenetic one, it has actually heightened the tensions between different ways of defining paternity. </p>
<p>Who’s your daddy? Perhaps science isn’t best positioned to answer, because this question arises from society, not nature. It might not be the right question anyway. A better one is, what does society want a father to be?</p>
<p>[<em>You’re smart and curious about the world. So are The Conversation’s authors and editors.</em> <a href="https://theconversation.com/us/newsletters/weekly-highlights-61?utm_source=TCUS&utm_medium=inline-link&utm_campaign=newsletter-text&utm_content=weeklysmart">You can get our highlights each weekend</a>.]</p>
<p><strong>Editors Note: A picture was been removed from this article after a request from the photographer</strong></p><img src="https://counter.theconversation.com/content/118566/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Nara Milanich has received funding from American Council of Learned Societies (ACLS).</span></em></p>Before the advent of genetic testing, definitions of paternity were primarily social and legal. Science has destabilized these older definitions, but it has not replaced them.Nara Milanich, Professor of History, Barnard CollegeLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1144282019-03-31T19:14:06Z2019-03-31T19:14:06ZHow DNA ancestry testing can change our ideas of who we are<figure><img src="https://images.theconversation.com/files/266228/original/file-20190328-139374-9u23bt.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">We’ve underestimated the extent of mixing between ancestral groups throughout human history. </span> <span class="attribution"><a class="source" href="https://www.shutterstock.com/image-photo/serious-people-335748890?src=hK77HCa3N4kFvFhogDNvtQ-1-29">from www.shutterstock.com</a></span></figcaption></figure><p>Have you ever wondered who you are or where you come from?</p>
<p>I think it’s a fundamental human desire to want to know this.</p>
<p>One way we’re seeing this curiosity play out is in the rise of the at-home DNA ancestry business. You’ve probably seen the ads for tests like 23andme and Ancestry DNA: you spit in a tube, and then receive a report breaking you down into neat little slices in a pie chart telling you that you’re, say, 30% German and 70% English. As a population geneticist, I find this fascinating.</p>
<p>But how does our collective interest in ancestry testing interact with our ideas and conversations about race?</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/a-dna-test-says-youve-got-indigenous-australian-ancestry-now-what-95785">A DNA test says you’ve got Indigenous Australian ancestry. Now what?</a>
</strong>
</em>
</p>
<hr>
<h2>‘No borders within us’</h2>
<p>Earlier this year, a Mexican airline, Aeromexico, ran a tongue-in-cheek ad campaign, called “<a href="https://www.youtube.com/watch?v=2sCeMTB5P6U">DNA Discounts</a>” with the slogan “there are no borders within us”. For the ad campaign they gathered a group of North Americans who were willing to take a DNA test and get their results on camera. This group contained some members with, let’s just say, a somewhat negative view of Mexico.</p>
<figure>
<iframe width="440" height="260" src="https://www.youtube.com/embed/2sCeMTB5P6U?wmode=transparent&start=0" frameborder="0" allowfullscreen=""></iframe>
<figcaption><span class="caption">Do you want to go to Mexico?</span></figcaption>
</figure>
<p>In the ad, the airline offered rewards to these people based on their DNA results, in the form of a discounted airline ticket to Mexico. The size of the discount depended on the amount of Mexican ancestry. If their test showed 15% Mexican ancestry, that meant a 15% discount. </p>
<p>The footage of people getting their results on camera is pretty funny, and some of them seemed somewhat surprised, and maybe even upset about their reported ancestry. <a href="https://www.cbsnews.com/news/aeromexico-dna-ad-discounts-commercial-trump-mexico-us/">More than half</a> of those tested appeared to have Mexican ancestry, even though they weren’t aware of it.</p>
<p>The slogan “there are no borders within us” has an element of political commentary related to Donald Trump’s border wall. But the ad also teaches us two important things. </p>
<p>It shows how DNA testing can challenge not just our ideas of race and identity, but our notion of being. Your genetic ancestry might be completely different from your cultural identity. Just ask the folks in the ad. </p>
<p>Beyond this, it also highlights how mainstream this kind of science has become, and how much DNA ancestry testing has entered into pop culture.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/five-things-to-consider-before-ordering-an-online-dna-test-92504">Five things to consider before ordering an online DNA test</a>
</strong>
</em>
</p>
<hr>
<h2>Recent, dark past</h2>
<p>I think we humans have always been interested in our ancestry, but it hasn’t always been a healthy interest – sometimes it’s been much darker and more sinister. And we don’t even have to look too far into the past to see that.</p>
<p>The <a href="https://pged.org/history-eugenics-and-genetics/">eugenics movement</a> was part science and part social engineering, and based on the idea that certain things – such as being poor, lazy, “<a href="https://acluva.org/en/news/shameful-history-eugenics-virginia">feeble-minded</a>” or criminal – were actually traits that were inherited in families. These traits were often linked to certain ancestries or racial groups using <a href="https://onlinelibrary.wiley.com/doi/pdf/10.1111/j.1469-1809.2011.00649.x">biased</a> methodology. </p>
<p><a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1127045/">Eugenics</a> was the idea that humanity could <a href="https://readingroom.law.gsu.edu/buckvbell/74/">engineer</a> a better future for itself by identifying and regulating these groups using science and technology.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/boyer-lectures-the-new-eugenics-is-the-same-as-the-old-just-in-fancier-clothes-103165">Boyer Lectures: the new eugenics is the same as the old, just in fancier clothes</a>
</strong>
</em>
</p>
<hr>
<p>In the United States in the early 20th century, eugenics became a recognised academic discipline at many prestigious universities – even <a href="https://harvardmagazine.com/2016/03/harvards-eugenics-era">Harvard</a>. By 1928, <a href="https://yalealumnimagazine.com/articles/3456-god-and-white-men-at-yale">almost 400</a> colleges and universities in America were teaching it. </p>
<p>In 1910 the <a href="http://library.cshl.edu/special-collections/eugenics">Eugenics Record Office</a> was set up to collect ancestry data, literally door to door. It then used this data to support racist agendas and <a href="https://library.missouri.edu/exhibits/eugenics/immigration.htm">influence</a> things like the <a href="https://history.state.gov/milestones/1921-1936/immigration-act">1924 Immigration Act</a> to curb immigration of southeastern Europeans, and ban <a href="http://historymatters.gmu.edu/d/5078">most</a> Asians and Arabs altogether. </p>
<p>Although we may think of eugenics as something linked with Nazi Germany in World War II, Hitler based some of his early <a href="http://historynewsnetwork.org/article/1796">ideas</a> about eugenics on these academic programs in the US. There was a fear of “pollution” of the purebred genetic lineage, and that the “inferior” races would contaminate the “superior” race. Many Nazi defendants at the Nuremberg trials claimed there wasn’t much difference between the Nazi eugenics program and the <a href="https://law.jrank.org/pages/2888/Buck-v-Bell-1927.html">ones in the US</a>.</p>
<h2>Racism with flawed science</h2>
<p>The events of that time are still relevant now. More than seven decades have passed and we’re seeing the rise of far-right groups and ideologies – the world of Trump, and the return of restrictive immigration policies. </p>
<p>We’re seeing a mainstreaming of ideas about race that we rejected not long ago. We’re once again seeing the science of genetics being misappropriated to support racist agendas. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/dramatic-advances-in-forensics-expose-the-need-for-genetic-data-legislation-105397">Dramatic advances in forensics expose the need for genetic data legislation</a>
</strong>
</em>
</p>
<hr>
<p>Late last year, the <a href="https://www.nytimes.com/2018/10/17/us/white-supremacists-science-dna.html">New York Times reported</a> on a trend among white supremacists to drink milk. Most people of northern European ancestry have a version of a certain gene, called a <a href="https://www.nature.com/news/archaeology-the-milk-revolution-1.13471">lactase</a> gene, that means they can fully digest milk as adults. This is due to a genetic mutation several thousand years ago, around the time of the first cattle herders in Europe. </p>
<p>The article described how people from the far right have taken this scientific result and run with it – producing bizarre YouTube videos in which people chug milk from 2-litre containers, swigging it and throwing it around in celebration of their supposed “genetic superiority” – and urging people who cannot digest milk to “go back”. Comedian <a href="https://www.youtube.com/watch?v=9YGB8gvYOPY&t=115">Stephen Colbert</a> even picked up on this story (in his words: “lactose is their only form of tolerance”).</p>
<p>The white supremacists took this bit of science and twisted it to suit their needs. But what they have ignored is research showing that a similar version of this gene evolved among cattle breeders in <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4700599/">East Africa</a> too.</p>
<h2>DNA does not define culture</h2>
<p>It’s not just popular culture: DNA ancestry has also entered political culture. </p>
<p>The right-wing Australian nationalist One Nation recently called for DNA ancestry tests as a <a href="https://www.sbs.com.au/nitv/article/2019/03/11/one-nation-aboriginal-indigenous-dna">requirement</a> to prove Aboriginal identity to access “benefits”. I don’t want to give this dangerous idea any more oxygen, and as a geneticist I can tell you it <a href="https://junkee.com/one-nation-aboriginal-dna-testing/197354">won’t work</a>. </p>
<p>Cultural identity is much more than simply what is in our DNA. Aboriginal communities are the ones who determine who is and who is not Indigenous. I think this episode highlights a worrying <a href="https://www.nytimes.com/2018/12/06/us/politics/elizabeth-warren-dna-test-2020.html">trend</a> for genetic tests to be seen as the ultimate decider of race and identity in public debates.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/why-dna-tests-for-indigenous-heritage-mean-different-things-in-australia-and-the-us-105367">Why DNA tests for Indigenous heritage mean different things in Australia and the US</a>
</strong>
</em>
</p>
<hr>
<p>So how does the marketing of the DNA companies themselves influence our thinking about ancestry?</p>
<p>These ancestry companies use the language of science in their marketing, and present their results as being highly scientific – which people interpret as meaning accurate and factual. The process of estimating ancestry from DNA <em>is</em> scientific, but people may not realise it can also be a bit of a blurry process, and actually more of an estimate. </p>
<p>When you look at your slice in the pie chart and it says 16% German, it is not a fact that you are 16% German. It’s an estimate, or an educated guess, of your ancestry based on statistical inference. </p>
<p>I think representation of our ancestries in pie charts is not helping our conversations.</p>
<h2>Twins got different results</h2>
<p>Recently, two <a href="https://www.cbc.ca/news/technology/dna-ancestry-kits-twins-marketplace-1.4980976">identical twins</a> put five DNA ancestry companies to the test, and this provides a really interesting look at how this process works. </p>
<p>The raw data for each twin was more than 99% identical, which shows that the way the companies produce the raw data is indeed quite accurate. </p>
<p>The shocking thing was that the companies provided each twin with noticeably different ancestry estimates.</p>
<p>From one company, the first twin got 25% Eastern European, and the second got 28%. Just to be clear, this shouldn’t happen with identical twins because they have the same DNA. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/genetic-ancestry-tests-dont-change-your-identity-but-you-might-98663">Genetic ancestry tests don’t change your identity, but you might</a>
</strong>
</em>
</p>
<hr>
<p>Even more surprising, one company said the twins were 27-29% Italian, but another said they were 19-20% Greek. A lot of this difference would be based on the size of the databases that the companies use as references and who is in the databases, and – very importantly – who has been left out of the databases. These factors would be different between the different companies, and change through time. </p>
<p>So the results you get now could be different to the results you might get in, say, six months when the databases are updated.</p>
<p>Estimating our ancestry is hard, and the main reason it is hard is because our ancestry is much more mixed up than some people might have thought. It’s not really so clear-cut as a pie chart might suggest. The statistics are blurry because our populations are blurry. </p>
<p>The bigger picture that’s emerging from DNA ancestry testing is that we’ve underestimated the extent of mixing between ancestral groups throughout human history.</p>
<p>Looking at the pie chart might give you the impression that there are discrete borders within you and boundaries between your different ancestries, but as Aeromexico so eloquently put it, “there are no borders within us”.</p>
<hr>
<p><em>This article is an edited version of a story presented on <a href="https://www.abc.net.au/radionational/programs/ockhamsrazor/dna-ancestry-testing-and-race/10943576">ABC’s Ockham’s Razor</a> and delivered at the World Science Festival, Brisbane in March 2019.</em></p><img src="https://counter.theconversation.com/content/114428/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Caitlin Curtis receives funding from Queensland Genomics Health Alliance. </span></em></p>Estimating our ancestry is hard – because our backgrounds are much more mixed up than we thought. So don’t take your DNA ancestry test results literally: they’re just a prediction.Caitlin Curtis, Research fellow, Centre for Policy Futures (Genomics), The University of QueenslandLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1052742018-10-22T13:40:35Z2018-10-22T13:40:35ZTwo Native American geneticists interpret Elizabeth Warren’s DNA test<p>Dr. Carlos Bustamante, a prominent population geneticist, <a href="https://www.bostonglobe.com/news/politics/2018/10/15/warren-addresses-native-american-issue/YEUaGzsefB0gPBe2AbmSVO/story.html?p1=Article_Inline_Bottom">recently concluded</a> that Senator Elizabeth Warren had “a Native American ancestor.” While geneticists agree on the <a href="https://www.forbes.com/sites/jenniferraff/2018/10/15/what-do-elizabeth-warrens-dna-test-results-actually-mean/#2507521912df">validity</a> of the test, which is based on established statistical models of DNA inheritance, we as two Native American geneticists find the interpretation to be <a href="https://www.theatlantic.com/ideas/archive/2018/10/what-make-elizabeth-warrens-dna-test/573205/">problematic</a>.</p>
<p>The reasons have to do with what we see as Warren’s motives, the genetic variants informing the comparison and overall concerns Native Americans have with genetic testing.</p>
<p>Because Bustamante used Indigenous individuals from Central and South America as a reference group to compare Warren’s DNA, we believe he should have stated only that Warren potentially had an “Indigenous” ancestor 6-10 generations ago, not conclusively a “Native American” one. The distinction might seem hypercritical to most, but to the sovereign tribal nations of the United States it’s an important one.</p>
<h2>Genetic controversies</h2>
<p>Our concern stems from the historical power imbalances around how genetic material has been collected.</p>
<p>Bustamante’s analysis utilized genetic data collected from Indigenous individuals as part of the <a href="http://www.internationalgenome.org/">1000 Genomes Project</a>. The project’s broad goal was to catalog genetic data from worldwide populations to advance knowledge of human diversity. </p>
<p>For Indigenous groups in the U.S. and globally, this approach has always been a concern. There is a <a href="https://www.voanews.com/a/native-americans-call-for-rethink-of-bering-strait-theory/3901792.html">cultural disconnect</a> between Indigenous origin stories and the practice of tracing human origins through DNA. </p>
<p>Adding to this, earlier ventures of cataloging Indigenous genetic variants, such as the <a href="https://www.the-scientist.com/news/proposed-human-genome-diversity-project-still-plagued-by-controversy-and-questions-57807">Human Genome Diversity Project</a> and <a href="http://www.ipcb.org/issues/human_genetics/htmls/factsheet.html">Genographic Project</a>, were denounced by the United Nations and Indigenous nations worldwide for a lack of engagement and transparency. The control and collection of genomic information from marginalized Indigenous groups led to concerns that such information could be used <a href="https://www.the-scientist.com/news/proposed-human-genome-diversity-project-still-plagued-by-controversy-and-questions-57807">for commercial gain</a> and opened the projects to accusations of exploitation. A <a href="https://www.un.org/development/desa/indigenouspeoples/declaration-on-the-rights-of-indigenous-peoples.html">declaration</a> in 2007 was passed calling for the cessation of genomic studies collecting Indigenous biomarkers.</p>
<p>While the 1000 Genomes Project learned from its predecessors and adopted more extensive <a href="http://www.internationalgenome.org/sample_collection_principles">consent</a> procedures, it and other large-scale ancestry projects publicly disclose the genomic information they collect, which is meant to advance research. But Indigenous groups’ concerns about having commercial companies profit from their genetic material without their inclusion has endured. Data from the 1000 Genomes Project and Human Genome Diversity Project, for instance, are used to inform percent Native American ancestry estimates as advertised by direct-to-consumer tests <a href="https://www.23andme.com/ancestry-composition-guide/">23andMe</a> and AncestryDNA, the latter of which posted a billion dollars in <a href="https://www.ancestry.com/corporate/about-ancestry/company-facts">revenue</a> in 2017.</p>
<p>Because of this and other <a href="https://www.nytimes.com/2010/04/22/us/22dna.html">recent genetic controversies</a> impacting Indigenous communities, Native Americans in the U.S. have been wary of participating in genomics research. Some tribes, like the <a href="http://genetics.ncai.org/what-do-tribes-think-about-genetics-research.cfm">Navajo Nation</a>, have long-standing moratoriums on genetics research. As such, Native American individuals constitute the <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5085287/">lowest</a> ethnic or minority group recruited into genomic studies. (We point to an ethical <a href="https://www.nature.com/articles/s41467-018-05188-3">framework</a> for engaging Indigenous communities that can address these concerns, developed by <a href="https://sing.igb.illinois.edu/">Indigenous geneticists</a>.)</p>
<h2>Genetic testing principles</h2>
<p>For these reasons, Bustamante could not use U.S. tribal groups in his analyses of Warren’s DNA. But how does this affect the interpretation?</p>
<p>These studies compare the genetic variants that an individual possesses to a reference group. In Bustamante’s analysis, he used 37 Indigenous individuals from Mexico, Peru and Colombia. Indigenous communities and nations across both continents exchanged goods, migrated and intermarried, and can be <a href="http://www.pnas.org/content/102/5/1312">culturally linked</a>. But considering that Indigenous peoples of Central and South American have <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2082466/">important different population and genetic histories</a> from tribes of the U.S., one can see that he utilized a proxy. </p>
<p>Importantly, most genetic tests sample only a subset of a person’s DNA at certain locations, or loci, on a person’s chromosomes. Often, a set of markers across a genomic region are passed onto progeny with other regions due to physical proximity on the DNA, although this is not the case for all parts of the genome. Statistics are then used to determine which loci are more likely to be co-inherited with others. </p>
<p>Although these tests utilize our best understandings of genetics and statistics, they are still predictions. And statements of statistical inferences should be in respect to the reference group sampled. So the conclusion, at its most conservative, is that Warren has a high statistical probability that her DNA points to an Indigenous ancestor.</p>
<h2>Demonstrating ancestry</h2>
<p>Warren claimed that her DNA test result corroborates <a href="https://www.bostonglobe.com/news/politics/2018/10/15/warren-addresses-native-american-issue/YEUaGzsefB0gPBe2AbmSVO/story.html">family lore</a> of a certain Cherokee ancestor but genealogical records show “<a href="https://www.theatlantic.com/politics/archive/2012/05/is-elizabeth-warren-native-american-or-what/257415/">no proof</a>” that her great-great-grandmother was part Cherokee. Thus, Warren has not demonstrated a direct lineal descent from an enrolled tribal member, a requirement for citizenship by all three of the federally recognized Cherokee tribes. Even further, the Cherokee Nation of Oklahoma denounced DNA tests as insufficient for determining lineage and “<a href="https://www.cherokee.org/News/Stories/20181015_Cherokee-Nation-responds-to-Senator-Warrens-DNA-test">inappropriate</a>.” </p>
<p>There are hundreds of thousands of Americans who <a href="https://slate.com/news-and-politics/2015/10/cherokee-blood-why-do-so-many-americans-believe-they-have-cherokee-ancestry.html">self-identify as Cherokee</a> or claim to have a Cherokee ancestor, and finding evidence can be difficult. </p>
<p>Determining which tribal census record – for instance, the <a href="https://www.cherokee.org/Portals/0/Documents/Registration/Tribal%20Registration%20Packet%20-%20Download.pdf?ver=2017-01-26-102513-520">Dawes Roll</a> or <a href="https://ebci.com/enrollment/">1924 Baker Roll</a> used by the Cherokee Nation of Oklahoma and Eastern Band of Cherokee Indians, respectively, for enrollment – requires specific knowledge of the ancestor in question. Even though the Dawes Roll has an extensive record of past enrollees, as Cherokee Nation of Oklahoma tribal member McKalee Steen told one of us (Tsosie), “there were a lot of people [who] were too afraid to sign it.” Those that refused voluntary enrollment were ultimately coerced or forced <a href="http://webtest2.cherokee.org/About-The-Nation/History/Biographies/Redbird-Smith">against their will to sign</a>, according to Cherokee Nation of Oklahoma citizen and genealogist <a href="https://twitter.com/pollysgdaughter/status/1054744101348929541">Twila Barnes</a>. In the following years, harsh assimilation policies and inconsistencies in federal documentation of racial status led many Cherokee to dissociate from previously-held tribal affiliation. The implications of this lasted well into the mid-20th century in Oklahoma, where Sen. Warren was raised.</p>
<p>Throughout this, Warren has stated that she understands the “distinction between citizenship and ancestry” and she does not seek tribal enrollment in the Cherokee Nation of Oklahoma. But even with the backlash by Native Americans, she still <a href="https://www.bostonglobe.com/metro/2018/10/16/warren-defends-decision-release-dna-test/2XIlJ4rhq8osxb1ipFjsvJ/story.html">defends</a> her decision to release her DNA test results. Her response, “I have an election,” and her immediate call to a <a href="https://www.vox.com/policy-and-politics/2018/10/15/17978258/elizabeth-warren-native-american-claims-dna-test">bet</a> with President Trump illuminates her political motives in trying to <a href="https://www.bia.gov/sites/bia_prod.opengov.ibmcloud.com/files/assets/public/pdf/Guide_to_Tracing_AI_and_AN_Ancestry.pdf">demonstrate a Native American ancestry</a>.</p>
<h2>Our concerns about DNA ancestry</h2>
<p>From our perspective, Warren has taken a complex and <a href="https://www.npr.org/sections/codeswitch/2018/02/09/583987261/so-what-exactly-is-blood-quantum">harmful history</a> of “Indian” blood quantification – a system we see as meant to <a href="https://papers.ssrn.com/sol3/papers.cfm?abstract_id=955032">dilute</a> our existence – and reduced it to a political ploy. As such, we ultimately see the test is about her own political gain.</p>
<p>In fact, we wish to be excluded from any conversation that conflates DNA ancestry with Indigenous or Native American identity. And the distinction is an important one – “Native American” is not just an ethnic term but it is a cultural and political designation. Tribal sovereignty, the ability to self-govern, is constructed on a special nation-to-nation relationship with the federal government and requires the ability to determine citizenship. To have this biologically reified and reduced to biomarkers from a broad definition of Indigenous peoples that each have their own histories is to threaten the very sovereign status that enables Native American cultural and traditional ways of living.</p>
<p><em>This article was updated on October 25 to clarify that signing the Dawes Roll was mandated by force.</em></p><img src="https://counter.theconversation.com/content/105274/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Krystal Tsosie is affiliated with Vanderbilt University as a doctoral student completing a PhD in Genomics and Health Disparities. She is an enrolled member of the Diné (Navajo) Nation.</span></em></p><p class="fine-print"><em><span>Matthew Anderson is affiliated with The Ohio State University where he is an assistant professor.. He is of Eastern Cherokee descent.</span></em></p>Why is Elizabeth Warren’s DNA test so controversial with Native American groups? Two Indigenous geneticists explain the history and science behind the debate.Krystal Tsosie, Ph.D. Student in Genomics and Health Disparities, Vanderbilt UniversityMatthew Anderson, Assistant Professor of Microbiology, The Ohio State UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/986632018-07-04T23:04:05Z2018-07-04T23:04:05ZGenetic ancestry tests don’t change your identity, but you might<figure><img src="https://images.theconversation.com/files/226198/original/file-20180704-73315-x8rs5h.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">Genetic ancestry testing might all seem like harmless fun, but there is a downside. </span> <span class="attribution"><span class="source">(Shutterstock)</span></span></figcaption></figure><p>You’ve probably seen that Ancestry commercial — the one where Kyle, who grew up German, takes a DNA test and discovers that his ancestry is mostly Scottish, and trades his lederhosen for a kilt. Or maybe you’ve seen the one where Kim learns from a DNA test that she is 26 per cent Native American and, surrounded by Native pottery, can finally know who she is.</p>
<p><a href="http://www.beacon.org/The-Social-Life-of-DNA-P1140.aspx">Genetic ancestry testing is a billion-dollar industry</a>, with test sales <a href="https://www.technologyreview.com/s/610233/2017-was-the-year-consumer-dna-testing-blew-up/">growing exponentially</a>. An estimated <a href="https://isogg.org/wiki/Autosomal_DNA_testing_comparison_chart">16 million tests have been sold</a> — most within the last few years. </p>
<p>A strong appeal of these tests is their promise to tell you “who you are.” While the testing companies no longer use the words “race” or “ethnicity,” <a href="https://www.ispot.tv/brands/dhv/ancestry">advertisements like those featuring Kyle and Kim</a> show that this is exactly what they are selling.</p>
<p>But before you rush out to discover your “true” race or ethnicity, you should know that these tests will not tell you this, or even who you “really” are. </p>
<p>This information is not hidden within your genes or revealed by these tests. And the only people who trade one set of ethnic garb for another as a result of these tests are those who are looking for a reason to do so.</p>
<h2>Ancestry tests often misunderstood</h2>
<p>For several years, I have been leading a large research project on genetic ancestry testing. During this time, I have learned that those pie charts showing percentages of ancestry <a href="https://pdfs.semanticscholar.org/c02c/8d84e95032ae737f35809cc6c3f2018e1ab3.pdf">are grossly oversimplified</a>, revealing <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2869013/">a probability rather than a definitive answer</a>. They <a href="http://journals.sagepub.com/doi/full/10.1177/0038038513493538">are based on science that is meant to address questions at the population level</a>, not about specific individuals.</p>
<p>But consumers often <a href="http://journals.sagepub.com/doi/abs/10.1177/0306312708091929">take their results seriously</a>. </p>
<p>As a social scientist who studies the way that <a href="https://link.springer.com/article/10.1007/s11206-005-1897-0">racial identities and categories change over time and place</a>, I believe <a href="https://www.sup.org/books/title/?id=16798">our ideas about race and ethnicity are shaped by societies</a> and not just what is found in our genes. </p>
<p>I wanted to find out whether test-takers view their results as definitive, and whether that might encourage them to view racial differences as purely biological.</p>
<figure>
<iframe width="440" height="260" src="https://www.youtube.com/embed/MQlmX7gvYRA?wmode=transparent&start=0" frameborder="0" allowfullscreen=""></iframe>
</figure>
<h2>‘Cherry picking’ identities</h2>
<p>My <a href="https://www.journals.uchicago.edu/doi/abs/10.1086/697487">recently published paper in the <em>American Journal of Sociology</em></a> shows that test consumers usually do not change their ethnic or racial identities after taking these tests. More than 60 per cent of those my research team and I interviewed said the test results did not affect their identity.</p>
<p>Those whose identities do change do not simply accept the test results as scientific fact. They cherry-pick from the results, adopting or rejecting particular identities based on which ones they view positively or negatively and their beliefs about what others will accept.</p>
<p>We see this with “Eduardo,” a Mexican-American man who initially identified as white Hispanic with Native American ancestry. His ancestry tests reported Native American, Celtic and Jewish ancestry. Eduardo embraced a new Jewish identity, explaining: “I always looked up to the Jewish people and Jewish friends and neighbours. I just feel better now because I’m one of them…I thought of them as higher than me: I have just now reached the top with them.”</p>
<p>But Eduardo rejected a Celtic identity, saying: “I can pass for a Jew, there’s no question about it. There’s no way I could pass for a Celtic, because I’m dark, and sort of fat, short. And because this ideal we have of the Celts, they’re tall, strong, big people….So…it’s just, ‘Stupid Mexican, dreaming he’s got Celtic blood in him.’” </p>
<p>Consumers like Eduardo often rely on stereotypes about what groups look and act like in deciding which ones to embrace. </p>
<figure class="align-center ">
<img alt="" src="https://images.theconversation.com/files/226194/original/file-20180704-73306-379ty1.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/226194/original/file-20180704-73306-379ty1.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=600&fit=crop&dpr=1 600w, https://images.theconversation.com/files/226194/original/file-20180704-73306-379ty1.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=600&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/226194/original/file-20180704-73306-379ty1.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=600&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/226194/original/file-20180704-73306-379ty1.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=753&fit=crop&dpr=1 754w, https://images.theconversation.com/files/226194/original/file-20180704-73306-379ty1.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=753&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/226194/original/file-20180704-73306-379ty1.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=753&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Most test-takers do not take their results as fact. They cherry pick from the results.</span>
<span class="attribution"><span class="source">Shutterstock</span></span>
</figcaption>
</figure>
<p>When their tests reported ancestries they did not like, test-takers ignored them. Or if they did not like their previous identity, they found others to replace it with. </p>
<p>“Amy” was adopted but told that her birth mother was German. She explained: “I was actually embarrassed to be German because of what happened with the Holocaust…. And I thought ‘I wish I could be from somewhere else and not be German.’” When her results reported German and Basque ancestry, she began identifying as Basque.</p>
<p>Some were looking to confirm a family story or an identity they view positively. “Shannon” was adopted and always believed she had Native American lineage through her birth parents. When her test results revealed no Native American ancestry, she decided the test must be wrong and continued to identify as Native American.</p>
<p>Rather than viewing their test results as providing objective “proof” of who they are, test-takers picked the truths they wanted from their tests.</p>
<h2>Whites change their identity most</h2>
<p>Most often in the study, it was white test consumers who adopted new racial or ethnic identities. They saw their initial identities as too bland or as not providing enough sense of belonging. They longed for what sociologists have called “<a href="https://www.cambridge.org/core/journals/du-bois-review-social-science-research-on-race/article/color-capital-white-debt-and-the-paradox-of-strong-white-racial-identities/FE845DE30B457103ABFC97FB053DA7AE">colour capital</a>,” a connection to something more interesting or exotic than “just white.”</p>
<p>Non-white consumers felt a strong sense of political and cultural connection to their existing ethnic and racial groups. While they found the results interesting, they generally felt no need to change their identity in light of them.</p>
<p>In addition, Black and Latino test-takers already knew they had mixed racial ancestry, because of the history of racial mixing within their groups. As “Marvin” explained: “My identity as a Black American…was not affected unduly because to be of mixed racial ancestry…does not place you outside of the Black group.”</p>
<h2>Consequences of testing</h2>
<p>Genetic ancestry testing might all seem like harmless fun, but there is a downside. When whites adopt “exotic” new racial identities, it fosters the view that race is costless, something that can be enjoyed without real consequences. That can promote a <a href="https://books.google.com.mx/books?id=QQglDwAAQBAJ&printsec=frontcover&dq=Bonilla-Silva,+racism+without+racists&hl=en&sa=X&ved=0ahUKEwjDuLbkv-HbAhVLA6wKHQkFB1YQ6AEIJzAA#v=onepage&q=Bonilla-Silva%2C%20racism%20without%20racists&f=false">false view that race is inconsequential today for everyone</a>.</p>
<p>Some suggest that these tests <a href="https://www.ssc.wisc.edu/soc/faculty/pages/docs/fujimura/bolnick_fujimura_et_al_genealogy_testing_Science_2007.pdf">may increase essentialist beliefs</a> — the view that racial groups have distinct abilities and skills that are determined by their genes, and which has <a href="https://www.ucpress.edu/book/9780520270312/the-nature-of-race">previously contributed to racial exclusion, discrimination and eugenics</a>. </p>
<p>Research shows that reading media articles that depict genetic ancestry tests as able to reveal your race <a href="http://journals.sagepub.com/doi/10.1177/0190272514529439">increases belief in essential racial differences</a>. My research with test consumers finds that they typically believe these tests support the views they already held: Those who believed that race was determined by genes before <a href="https://pwias.ubc.ca/videos/genetic-ancestry-testing-and-the-meaning-race-wendy-roth">claimed that these tests offer proof of that view</a>.</p>
<p>If you’re going to buy a genetic ancestry test, you need to educate yourself on the science behind them and what they can and cannot tell you. And don’t buy these tests to find out your race or ethnicity. The science is unable to tell you this. </p>
<p>The experience of test consumers shows that these tests reinforce what you want to believe rather than offering objective, scientific proof of who you are.</p>
<p>And the next time you see someone buying a new kilt or Native pottery after taking a genetic ancestry test, remember that the test didn’t change who they are; they simply wanted to believe it did.</p><img src="https://counter.theconversation.com/content/98663/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Wendy D. Roth receives funding from the Social Sciences and Humanities Research Council of Canada and the Canada Foundation for Innovation.</span></em></p>The results of genetic ancestry tests are grossly over-simplified. A new study shows the tests reinforce what you want to believe rather than offering objective, scientific proof of who you are.Wendy D. Roth, Associate Professor of Sociology, University of British ColumbiaLicensed as Creative Commons – attribution, no derivatives.