tag:theconversation.com,2011:/au/topics/forensic-science-1229/articlesForensic science – The Conversation2024-01-16T13:40:18Ztag:theconversation.com,2011:article/2162442024-01-16T13:40:18Z2024-01-16T13:40:18ZYour fingerprint is actually 3D − research into holograms could improve forensic fingerprint analysis<figure><img src="https://images.theconversation.com/files/565336/original/file-20231212-25-54j3sc.jpg?ixlib=rb-1.1.0&rect=4%2C17%2C2895%2C2056&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">Fingerprints have been used as unique identifiers for decades. </span> <span class="attribution"><a class="source" href="https://newsroom.ap.org/detail/BabeRuthAuction/02eed90749c4440d91a7a4e4ea305c6b/photo?Query=fingerprint&mediaType=photo&sortBy=&dateRange=Anytime&totalCount=949&currentItemNo=18">AP Photo/Patrick Semansky</a></span></figcaption></figure><p>When you use your fingerprint to unlock your smartphone, your phone is looking at a two-dimensional pattern to determine whether it’s the correct fingerprint before it unlocks for you. But the imprint your finger leaves on the surface of the button is actually a 3D structure called a fingermark. </p>
<p>Fingermarks are made up of tiny ridges of oil from your skin. Each ridge is only a few microns tall, or a few hundredths of the thickness of human hair.</p>
<p>Biometric identifiers record fingermarks only as 2D pictures, and although these carry a lot of information, there’s a lot missing. A 2D fingerprint neglects the depth of the fingermark, including pores and scars buried in the ridges of fingers that are difficult to see.</p>
<p>I’m an <a href="https://udayton.edu/directory/engineering/electrical_and_computer/banerjee_partha.php">educator and scientist</a> who studies holography, a field of research that focuses on how to display 3D information. My lab has created a way to map and visualize fingermarks in three dimensions from any perspective on a computer – <a href="https://theconversation.com/five-surprising-ways-holograms-are-revolutionising-the-world-77886">using digital holography</a>.</p>
<h2>Fingermark types</h2>
<p>Scientists categorize fingermarks as either patent, plastic or latent, depending on how visible they are when left on a surface.</p>
<p>Patent fingermarks are the most visible type – bloody fingerprints at crime scenes are one example. Plastic fingermarks are found on soft surfaces, such as clay, Play-Doh or chocolate bars. The human eye can see both <a href="https://doi.org/10.1201/b12882">patent and plastic fingermarks quite easily</a>.</p>
<p>The least visible are latent fingermarks. These are usually found on hard surfaces such as <a href="https://doi.org/10.1201/b12882">glass, metals, woods and plastics</a>. To make them out, a fingerprint examiner has to use physical or chemical methods such as dusting with powder, creating chemical reactions with appropriate reagents or <a href="https://doi.org/10.1186/s41935-017-0009-7">cyanoacrylate fuming</a>. </p>
<p>Cyanoacrylate makes super glue in <a href="https://nij.ojp.gov/library/publications/fingerprint-sourcebook">its liquid form</a>, but as a gas it can make latent fingermarks visible. Researchers develop the prints by letting cyanoacrylate vapor molecules react with components in the latent fingerprint residue.</p>
<p>The geometric details on fingermarks are categorized into three levels. Level 1 encompasses <a href="https://www.forensicsciencesimplified.org/prints/principles.html">visible ridge patterns</a>, so loops, whorls and arches. Level 2 refers to <a href="https://nij.ojp.gov/library/publications/fingerprint-sourcebook">minutiae or small details</a>, such as bifurcations, endings, eyes and hooks. </p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/565337/original/file-20231212-15-ry9tua.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="Three fingerprint ridge patterns shown in black and white. The ridges on the left look like a hill, the center looks like a hill with a loop on top, and on the right the ridges form a circle." src="https://images.theconversation.com/files/565337/original/file-20231212-15-ry9tua.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/565337/original/file-20231212-15-ry9tua.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=233&fit=crop&dpr=1 600w, https://images.theconversation.com/files/565337/original/file-20231212-15-ry9tua.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=233&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/565337/original/file-20231212-15-ry9tua.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=233&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/565337/original/file-20231212-15-ry9tua.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=293&fit=crop&dpr=1 754w, https://images.theconversation.com/files/565337/original/file-20231212-15-ry9tua.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=293&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/565337/original/file-20231212-15-ry9tua.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=293&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Fingerprints have visible ridge structures, such as arches (left), whorls (middle) and loops (right), but at the microscopic level they have much finer patterns and structures.</span>
<span class="attribution"><a class="source" href="https://commons.wikimedia.org/wiki/File:%D0%9F%D0%B0%D0%BB%D1%8C%D1%86%D0%B5%D0%B2%D1%8B%D0%B5_%D1%83%D0%B7%D0%BE%D1%80%D1%8B.jpg">ValeriyPolunovskiy/Wikimedia Commons</a>, <a class="license" href="http://creativecommons.org/licenses/by-sa/4.0/">CC BY-SA</a></span>
</figcaption>
</figure>
<p>Finally, Level 3 features, such as pores, scars and creases, are too small for the human eye to resolve. This is where <a href="https://doi.org/10.1117/1.OE.56.3.034117">optical techniques</a> like holography come in handy, since optical wavelengths are in the order of microns, small enough to make out small details on an object.</p>
<h2>Developing fingermark holograms</h2>
<p>Since fingermarks are usually collected as 2D pictures, and holograms display 3D information, my team wanted to develop a technique that can show all the 3D topological characteristics of a fingermark.</p>
<p>To do this, we’ve been collaborating with <a href="https://scholar.google.com/citations?user=wC7o_VAAAAAJ&hl=en">Akhlesh Lakhtakia’s group</a> at Penn State. They developed a specialized technique that deposits a <a href="https://doi.org/10.1117/1.OE.56.3.034117">nanoscale columnar thin film</a> layer, called a CTF, on top of the fingermark to develop and preserve it. </p>
<p>Columnar thin films are dense pillars of <a href="https://doi.org/10.1117/1.OE.56.3.034117">glassy material</a> that uniformly cover the fingermark, like a dense growth of identical trees in a forest. Just as the tops of these trees would reflect the topology of the ground, the tops of these columnar thin films <a href="https://doi.org/10.1016/j.ijleo.2023.171541">replicate the 3D structure</a> of the fingermarks on which they are deposited. </p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/558698/original/file-20231109-15-x4lbc9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="A man wearing a blue shirt and green vest, as well as a blue glove, holds a clear petri dish upright, which has three small red squares with fingermarks on them inside." src="https://images.theconversation.com/files/558698/original/file-20231109-15-x4lbc9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/558698/original/file-20231109-15-x4lbc9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/558698/original/file-20231109-15-x4lbc9.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/558698/original/file-20231109-15-x4lbc9.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/558698/original/file-20231109-15-x4lbc9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/558698/original/file-20231109-15-x4lbc9.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/558698/original/file-20231109-15-x4lbc9.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Samples collected using CTF film.</span>
<span class="attribution"><span class="source">Banerjee Lab</span></span>
</figcaption>
</figure>
<p><a href="https://science.howstuffworks.com/hologram.htm">To make a hologram</a> of something like a 3D fingermark, researchers split light from a laser into two parts. One part, called the reference wave, shines directly on a digital camera. The other wave shines on the object, in this case the fingermark. </p>
<p>If the object is reflective, the reflected light is also <a href="https://doi.org/10.1117/1.OE.56.3.034117">directed to the digital camera</a> and <a href="https://spie.org/publications/book/2190843?SSO=1">superimposed on the reference wave</a>.</p>
<p>The superposition of waves – both from the reference and the object – creates an interference pattern, which is called a hologram. In digital holography, this hologram, which is a 2D picture, is recorded in the digital camera. Researchers then import the hologram to a computer, where they can use the physical laws of wave propagation to figure out where the light waves from the laser bounced off different parts of the object. </p>
<p>This process allows them <a href="https://spie.org/publications/book/2190843?SSO=1">to reconstruct the object</a> as a 3D picture.</p>
<p>So, the reconstructed hologram has <a href="https://www.biblio.com/book/principles-applied-optics-banerjee-partha-p/d/1473721348">all the 3D details of the object</a>, and you can now visualize the 3D object on a laptop <a href="https://spie.org/publications/book/2190843?SSO=1">from any perspective</a>. </p>
<h2>Picking up fingermarks</h2>
<p>In 2017, our collaboration <a href="https://doi.org/10.1117/1.OE.56.3.034117">reported our first results</a>, where we made 3D pictures of latent fingermarks using the CTF technique. We recorded holograms of the CTF-developed fingermarks with two different wavelengths of light – green and blue – generated from a laser. Using two different wavelengths allowed us to make out tiny details such as pores in the 3D reconstructions. </p>
<p>Lakhtakia’s research group has deposited hundreds of fingermarks on glass, wood and plastic. They’ve then let them age in different environments, at various temperatures and humidity levels, before coating them with CTF film to pick up the fingerprint. My group records the digital holograms of these fingermarks and visualizes them in 3D on a computer. </p>
<p>We have also started working on a better 3D fingermark analysis plan to help identify crime suspects.</p>
<p>The <a href="https://www.mcohio.org/816/Miami-Valley-Regional-Crime-Lab">Miami Valley Regional Crime Lab</a> in Dayton, Ohio, has graded the quality of the fingermarks captured by Lakhtakia’s research group. It will also help us develop a new method for grading the 3D holographic reconstructions, something that does not currently exist. This may involve creating categories to classify how clear the 3D renderings of the fingermarks are.</p>
<p>The use of fingerprints as unique identifiers has a long history, going back to <a href="https://nij.ojp.gov/library/publications/fingerprint-sourcebook">ancient Babylonian and Chinese civilizations</a>. They’ve been used for forensic purposes <a href="https://doi.org/10.1016/j.endeavour.2023.100863">since the late 1890s</a>, starting in Calcutta, India. Our work aims to build on this rich history and use cutting-edge technologies to improve fingermark analysis.</p><img src="https://counter.theconversation.com/content/216244/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Partha Banerjee’s Holography and Metamaterials (HaM) Lab has used Digital Holography for many applications funded by DARPA, Air Force and Army. The current joint work on fingermarks is supported by a grant from the Criminal Investigations and Network Analysis (CINA) Center of the Department of Homeland Security (DHS). </span></em></p>Using fingerprints to catch criminals isn’t 100% accurate, but analyzing fingerprints in 3D, rather than 2D, could improve the process.Partha Banerjee, Professor of Electrical and Computer Engineering, University of DaytonLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/2133582024-01-03T20:26:46Z2024-01-03T20:26:46ZThe strange story of the grave of Copernicus<figure><img src="https://images.theconversation.com/files/565952/original/file-20231215-19-1ympo4.jpg?ixlib=rb-1.1.0&rect=0%2C5%2C3994%2C2862&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">Astronomer Copernicus, or Conversations with God (1873)</span> <span class="attribution"><a class="source" href="https://en.wikipedia.org/wiki/Astronomer_Copernicus,_or_Conversations_with_God#/media/File:Jan_Matejko-Astronomer_Copernicus-Conversation_with_God.jpg">Jan Matejko / Wikimedia Commons</a></span></figcaption></figure><p>Nicholas Copernicus was the astronomer who, five centuries ago, explained that Earth revolves around the Sun, rather than vice versa. A true Renaissance man, he also practised as a mathematician, engineer, author, economic theorist and medical doctor.</p>
<p>Upon his death in 1543 in Frombork, Poland, Copernicus was buried in the local cathedral. Over the subsequent centuries, the location of his grave was lost to history.</p>
<h2>Who was Copernicus?</h2>
<figure class="align-right ">
<img alt="A portrait of a serious looking man" src="https://images.theconversation.com/files/565954/original/file-20231215-25-i46ixp.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=237&fit=clip" srcset="https://images.theconversation.com/files/565954/original/file-20231215-25-i46ixp.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=587&fit=crop&dpr=1 600w, https://images.theconversation.com/files/565954/original/file-20231215-25-i46ixp.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=587&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/565954/original/file-20231215-25-i46ixp.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=587&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/565954/original/file-20231215-25-i46ixp.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=737&fit=crop&dpr=1 754w, https://images.theconversation.com/files/565954/original/file-20231215-25-i46ixp.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=737&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/565954/original/file-20231215-25-i46ixp.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=737&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">A portrait of Nicolaus Copernicus from the town hall of Toruń (circa 1580).</span>
<span class="attribution"><a class="source" href="https://en.wikipedia.org/wiki/Nicolaus_Copernicus#/media/File:Nikolaus_Kopernikus.jpg">Unknown artist / Wikimedia</a></span>
</figcaption>
</figure>
<p><a href="https://www.nature.com/articles/152408c0">Nicholas Copernicus</a>, or Mikołaj Kopernik in Polish, was born in Toruń in 1473. He was the youngest of four children born to a local merchant. </p>
<p>After his father’s death, Copernicus’s uncle assumed responsibility for his education. The young scholar initially studied at the University of Kraków between 1491 and 1494, and later at Italian universities in Bologna, Padua and Ferrara.</p>
<p>After studying medicine, canon law, mathematical astronomy, and astrology, Copernicus returned home in 1503. He then worked for his influential uncle, Lucas Watzenrode the Younger, who was the Prince-Bishop of Warmia.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/copernicus-revolution-and-galileos-vision-our-changing-view-of-the-universe-in-pictures-60103">Copernicus' revolution and Galileo's vision: our changing view of the universe in pictures</a>
</strong>
</em>
</p>
<hr>
<p>Copernicus <a href="https://pubmed.ncbi.nlm.nih.gov/21614776/">worked as a physician</a> while continuing his research in mathematics. At that time, both astronomy and music were considered branches of mathematics. </p>
<p>During this period, he formulated two influential economic theories. In 1517, he developed the <a href="https://onlinelibrary.wiley.com/doi/10.1111/1468-0289.00063">quantity theory of money</a>, which was later re-articulated by John Locke and David Hume, and popularised by Milton Friedman in the 1960s. In 1519, Copernicus also introduced the concept now known as <a href="https://www.jstor.org/stable/25776118">Gresham’s law</a>, a monetary principle addressing the circulation and valuation of money.</p>
<figure class="align-center ">
<img alt="A photo of a large brick cathedral." src="https://images.theconversation.com/files/548664/original/file-20230917-29-ztk9ck.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/548664/original/file-20230917-29-ztk9ck.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=450&fit=crop&dpr=1 600w, https://images.theconversation.com/files/548664/original/file-20230917-29-ztk9ck.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=450&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/548664/original/file-20230917-29-ztk9ck.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=450&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/548664/original/file-20230917-29-ztk9ck.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=566&fit=crop&dpr=1 754w, https://images.theconversation.com/files/548664/original/file-20230917-29-ztk9ck.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=566&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/548664/original/file-20230917-29-ztk9ck.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=566&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Nicholas Copernicus was buried in Frombork Cathedral.</span>
<span class="attribution"><a class="source" href="https://en.wikipedia.org/wiki/Archcathedral_Basilica_of_the_Assumption_of_the_Blessed_Virgin_Mary_and_St._Andrew%2C_Frombork#/media/File:Frauenburger_Dom_2010.jpg">Holger Weinant / Wikimedia</a>, <a class="license" href="http://creativecommons.org/licenses/by-sa/4.0/">CC BY-SA</a></span>
</figcaption>
</figure>
<h2>The Copernican model of the universe</h2>
<p>The cornerstone of Copernicus’s contributions to science was his revolutionary model of the universe. Contrary to the prevailing Ptolemaic model, which maintained that Earth was the stationary centre of the universe, Copernicus argued that Earth and other planets revolve around the Sun.</p>
<p>Copernicus was further able to compare the sizes of the planetary orbits by expressing them in terms of the distance between the Sun and Earth.</p>
<p>Copernicus feared how his work would be received by the church and fellow scholars. His magnum opus, “<a href="https://www.gla.ac.uk/myglasgow/library/files/special/exhibns/month/apr2008.html">De Revolutionibus Orbium Coelestium</a>” (On the Movement of the Celestial Spheres), was only published just before his death in 1543. </p>
<p>The publication of this work set the stage for groundbreaking shifts in our understanding of the universe, paving the way for future astronomers such as Galileo, who was born more than 20 years after Copernicus’s death.</p>
<h2>The search for Copernicus</h2>
<p>The Frombork Cathedral serves as the final resting place of more than 100 people, most of whom lie in unnamed graves.</p>
<p>There were several unsuccessful attempts to locate Copernicus’s remains, dating as far back as the 16th and 17th centuries. Another failed attempt was made by the French emperor Napoleon after the 1807 Battle of Eylau. Napoleon held Copernicus in high regard as a polymath, mathematician and astronomer.</p>
<figure class="align-center ">
<img alt="Photo of the inside of a cathedral" src="https://images.theconversation.com/files/565958/original/file-20231215-17-kqh2zj.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/565958/original/file-20231215-17-kqh2zj.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/565958/original/file-20231215-17-kqh2zj.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/565958/original/file-20231215-17-kqh2zj.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/565958/original/file-20231215-17-kqh2zj.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/565958/original/file-20231215-17-kqh2zj.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/565958/original/file-20231215-17-kqh2zj.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Historians believed Copernicus would have been buried near a particular altar in Frombork Cathedral.</span>
<span class="attribution"><a class="source" href="https://en.wikipedia.org/wiki/Archcathedral_Basilica_of_the_Assumption_of_the_Blessed_Virgin_Mary_and_St._Andrew%2C_Frombork#/media/File:Frombork_Cathedral_Interior.jpg">Julian Nyča / Wikimedia</a>, <a class="license" href="http://creativecommons.org/licenses/by-sa/4.0/">CC BY-SA</a></span>
</figcaption>
</figure>
<p>In 2005, a group of Polish archaeologists took up the search. </p>
<p>They were guided by the theory of historian Jerzy Sikorski, who claimed that Copernicus, serving as the Canon of Frombork Cathedral, would have been buried near the cathedral altar for which he was responsible during his tenure. This was the Altar of Saint Wacław, now known as the Altar of the Holy Cross.</p>
<p>Thirteen skeletons were discovered near this altar, including an <a href="https://www.smithsonianmag.com/history/copernicus-unearthed-115715830/">incomplete skeleton</a> belonging to a male aged between 60 and 70 years. This particular skeleton was identified as the closest match to that of Copernicus. </p>
<h2>Forensic science</h2>
<figure class="align-right zoomable">
<a href="https://images.theconversation.com/files/548662/original/file-20230917-23-c6vx5.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="Photos of a human skull from the front and side." src="https://images.theconversation.com/files/548662/original/file-20230917-23-c6vx5.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=237&fit=clip" srcset="https://images.theconversation.com/files/548662/original/file-20230917-23-c6vx5.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=450&fit=crop&dpr=1 600w, https://images.theconversation.com/files/548662/original/file-20230917-23-c6vx5.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=450&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/548662/original/file-20230917-23-c6vx5.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=450&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/548662/original/file-20230917-23-c6vx5.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=566&fit=crop&dpr=1 754w, https://images.theconversation.com/files/548662/original/file-20230917-23-c6vx5.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=566&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/548662/original/file-20230917-23-c6vx5.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=566&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">A skull believed to belong to Copernicus.</span>
<span class="attribution"><a class="source" href="https://clkp.policja.pl/clk/badania-i-projekty/ciekawe-badania/172502,Czy-tak-wygladal-Mikolaj-Kopernik.html">Dariusz Zajdel / Centralne Laboratorium Kryminalistyczne Policji</a></span>
</figcaption>
</figure>
<p>The skull of the skeleton served as the basis for a facial reconstruction.</p>
<p>In addition to morphological studies, DNA analysis is often used for the <a href="https://www.pnas.org/doi/10.1073/pnas.0907491106">identification of historical or ancient remains</a>. In the case of the presumed remains of Copernicus, a genetic identification was possible due to the well-preserved state of the teeth. </p>
<p>A significant challenge lay in identifying a suitable source of reference material. There were no known remains of any relatives of Copernicus.</p>
<h2>An unlikely find</h2>
<p>In 2006, however, a new source of DNA reference material came to life. An astronomical reference book used by Copernicus for many years was found to contain hair among its pages. </p>
<p>This book had been taken to Sweden as war booty following the Swedish invasion of Poland in the mid-17th century. It is currently in the possession of the Museum Gustavianum at Uppsala University. </p>
<p>A meticulous examination of the book revealed several hairs, thought likely to belong to the book’s primary user, Copernicus himself. Consequently, these hairs were assessed as potential reference material for genetic comparison with the teeth and bone matter recovered from the tomb.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/who-owned-this-stone-age-jewellery-new-forensic-tools-offer-an-unprecedented-answer-204797">Who owned this Stone Age jewellery? New forensic tools offer an unprecedented answer</a>
</strong>
</em>
</p>
<hr>
<p>The hairs were compared with the <a href="https://cs.astronomy.com/asy/b/astronomy/archive/2009/10/22/nicolaus-copernicus-old-old-blue-eyes.aspx">DNA from the teeth and bones</a> of the discovered skeleton. Both the mitochondrial DNA from the teeth and the skeletal sample matched those of the hairs, strongly suggesting that the remains were indeed those of Nicholas Copernicus.</p>
<p>The multidisciplinary effort, involving archaeological excavation, morphological studies and advanced DNA analysis, has led to a compelling conclusion. </p>
<p>The remains discovered near the Altar of the Holy Cross in Frombork Cathedral are highly likely to be those of Nicholas Copernicus. This monumental find not only sheds light on the final resting place of one of the most influential figures in the history of science, but also showcases the depth and sophistication of modern scientific methods in corroborating historical data.</p><img src="https://counter.theconversation.com/content/213358/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Darius von Guttner Sporzynski does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>A team of archaeologists discovered the remains of the 16th-century father of modern astronomy, who demonstrated that the Earth orbits the Sun.Darius von Guttner Sporzynski, Historian, Australian Catholic UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/2006352023-11-08T06:45:09Z2023-11-08T06:45:09ZThe words that helped wrongly convict Kathleen Folbigg<blockquote>
<p><strong>Prosecutor:</strong> Are you able to say whether or not Caleb died from a catastrophic asphyxiating event of unknown causes? </p>
<p><strong>Pathologist:</strong> I believe that is likely. […]</p>
<p><strong>Prosecutor:</strong> In relation to Laura […] her cause of death was consistent with smothering? </p>
<p><strong>Pathologist:</strong> Yes.</p>
<p><strong>Prosecutor:</strong> Including deliberate smothering?</p>
<p><strong>Pathologist:</strong> Yes.</p>
<p><strong>Prosecutor:</strong> And that she probably died from an acute catastrophic asphyxiating event of unknown causes?</p>
<p><strong>Pathologist:</strong> Yes. – (<a href="https://www.folbigginquiry.justice.nsw.gov.au/Documents/Amended%20Exhibit%20F.pdf">Transcript pp. 746-48</a>)</p>
</blockquote>
<p>The above exchange occurred during the seven-week trial leading to Kathleen Folbigg’s conviction for the deaths of her four infant children (Caleb, Patrick, Sarah and Laura) between 1989 and 1999. During the trial, the word “asphyxia” in its various forms (-ate; -ation; -ating) was used 208 times; “smother” (-ing; -ed) 221 times; and “consistent with” 233 times. </p>
<p>The pathologists and doctors concurred that the absence of external injuries was “consistent with” Caleb dying of a “catastrophic asphyxiating event”. This was repeated for each of the four children by each of the doctors, with strangling or smothering likely to be uppermost in the minds of the jurors. </p>
<p>Of course, Folbigg’s wrongful conviction had <a href="https://johnmenadue.com/the-wrongful-conviction-of-kathleen-folbigg-why-did-it-happen-and-what-must-be-done-to-stop-it-from-happening-again/">numerous factors</a>. We have no way of knowing why the jury decided as it did. </p>
<p>But there are good reasons for forensic medicine practitioners and advocates to rethink their understanding – and use – of these words. </p>
<p><div data-react-class="Tweet" data-react-props="{"tweetId":"1665541958306078720"}"></div></p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/how-witch-hunts-and-stockholm-syndrome-became-part-of-political-language-and-what-it-has-to-do-with-wrestling-209375">How 'witch-hunts' and 'Stockholm syndrome' became part of political language (and what it has to do with wrestling)</a>
</strong>
</em>
</p>
<hr>
<h2>The semantic journey of asphyxia</h2>
<p>“Asphyxia” first appeared <a href="https://quod.lib.umich.edu/cgi/t/text/text-idx?c=eebo2;idno=B22610.0001.001">in print</a> in 1699 defined as “without any Pulse, or sign of Life”. Predictably, this meaning “stoppage of pulse” then sprouted the meaning “stoppage of respiration” – a lack of breath is a salient sign of lifelessness. </p>
<p>Subsequently, the path has been rocky, and it is now understood variously by forensic doctors around the world. What is agreed, however, is that “asphyxia” is not a diagnosis; it is not a condition that can be pointed at or diagnosed. </p>
<p>As far as lay understandings go, things get murkier. Modern dictionaries list many senses but privilege “respiratory failure”, with “suffocation” usually given as a synonym; this in turn is defined as the interruption of breathing, including some means by which it’s brought about (for example, smothering, throttling). </p>
<p>The Urban Dictionary’s definition for “asphyxiation” is “death by strangulation; ergo blockage in air passage”. This dictionary has its problems, but like other collaboratively constructed dictionaries, it is useful for tracking contemporary social meanings of expressions not yet in more mainstream dictionaries.</p>
<h2>More murkiness</h2>
<p>In the trial, confused senses of “asphyxia” were combined with the misleading phrase “consistent with”. As used by experts, this is synonymous with “may or may not mean”. </p>
<p><a href="https://repository.uclawsf.edu/hastings_law_journal/vol59/iss5/7/">Research</a> shows, however, that people without expert knowledge hear the phrase as strong confirmation of the proposed connection.</p>
<p>In the <a href="http://netk.net.au/Canada/Morin10.asp">1998 Canadian inquiry</a> into the (wrongful) conviction of Canadian man Guy Paul Morin, Commissioner Kaufman was scathing in his criticism of the use of “consistent with”. He regarded it as demonstrably misleading language, variably being used to mean:</p>
<blockquote>
<p>‘could have come, or cannot be excluded as coming, from the accused’; ‘not inconsistent with’; ‘more than a possibility but less than a probability’; ‘perfect or near identity of two items’.</p>
</blockquote>
<p>The <a href="https://www.oed.com/dictionary/consistent_adj?tab=meaning_and_use">historical thesaurus</a> of the Oxford English Dictionary suggests this last sense “perfect or near identity of two items” has been around since the 1600s. Clearly, we can’t assume people today would automatically understand “consistent with” as simply a way of saying what is proposed is possible.</p>
<h2>Bad meanings drive out good</h2>
<p>The meanings we carry around in our heads seem so natural we fail to realise other people can have quite different understandings. </p>
<p>As linguist <a href="https://oxford.universitypressscholarship.com/view/10.1093/acprof:oso/9780198709831.001.0001/acprof-9780198709831">Nick Enfield</a> describes, we hypothesise what others mean by the words they use. And the more unusual a word is, the more its meanings will vary because we aren’t given the same opportunities to refine our hypotheses. </p>
<p>For example, what part of the foot do you understand as the “instep” – the upper surface between toes and ankle, the underneath part, or perhaps both the top and underneath? All three meanings are out there, and different dictionaries favour different ones. </p>
<p>Does this really matter? In a highly circumstantial murder trial, it does.</p>
<p>Words are <a href="https://www.cambridge.org/core/books/forbidden-words/E7E4C037E8F1A91DE2ECA05CD70A3078">far more likely</a> to take on negative overtones than favourable ones. The linguistic evidence is compelling – negative senses come to dominate and eventually quash all other senses. This transformation has a name: Gresham’s Law of Semantic Change.</p>
<p>It comes as no surprise that crowdsourced online dictionaries show the homicidal senses of “asphyxia” (and its derived forms) as winning out.</p>
<p><div data-react-class="Tweet" data-react-props="{"tweetId":"1665557473841774593"}"></div></p>
<h2>Asphyxia permeated Kathleen Folbigg’s trial</h2>
<p>Importantly, it was agreed by all involved none of the babies showed any injuries. (Two pinpoint scratches on Sarah’s lower lip were agreed to be of no significance).<br>
As the prosecutor said: </p>
<blockquote>
<p>All they [the doctors] can say is that there was some form of obstruction that caused oxygen not to be able to get into the lungs and that’s what caused these babies to die […] all they can say is that it was induced asphyxiation from an external cause […]“ (<a href="https://www.folbigginquiry.justice.nsw.gov.au/Documents/Amended%20Exhibit%20F.pdf">Transcript p. 66</a>)_</p>
</blockquote>
<p>It was repeatedly asserted the presence of no injuries in any of the Folbigg children "was consistent with the occurrence of an acute catastrophic asphyxiating event” or “smothering”. This was probably heard by the jury as indicating no injuries meant an “asphyxial event” had occurred – in other words, the children had been strangled or smothered. </p>
<p>There was also repeated reference to the absence of natural explanations for four sudden and unexplained deaths in one family – with the unstated inference that the only reasonable explanation was homicide. Known as Meadows Law, this inference stalked Kathleen Folbigg’s trial and her subsequent appeals relentlessly. Meadows Law falls at the first hurdle: how likely is it there would be four murders – where there are no injuries – masquerading as natural deaths? </p>
<p>In <a href="https://www.austlii.edu.au/cgi-bin/viewdoc/au/cases/nsw/NSWSC/2003/895.html?context=1;query=R%20v%20Folbigg;mask_path=au/cases/nsw/NSWSC">his sentencing remarks</a>, the judge stated:</p>
<blockquote>
<p>No (expert) witness was prepared to say that the signs pointed only to smothering but the medical evidence generally was that the result of each event was consistent with having been caused by acute asphyxiation. The jury accepted that evidence.</p>
</blockquote>
<p>That summary encompasses the following linguistic storm: the doctors might say they thought the prosecutor was talking about asphyxia as meaning hypoxia/anoxia (low oxygen levels) due to any one of a myriad of causes.</p>
<p>The prosecutor believed he was asking whether, and the doctors were telling him that, the babies died from induced airways obstruction from external causes. And the jury thought they were being told the babies were smothered, or even strangled.<br>
All of this is medically incoherent and incapable of establishing anything of significance – but probably had a powerful effect on the jury. </p>
<h2>'The wisdom of the crowd’</h2>
<p>Since its first appearance in English in the 1600s, the term “asphyxia” has caused confusion. </p>
<p>In forensic pathology, it encompasses a number of concepts and is used variously by pathologists – and these uses are out of alignment with common lay usage. Combined with different understandings of “consistent with”, this confusion was very much to Folbigg’s disadvantage. </p>
<p>The jury system relies on “the wisdom of the crowd”. Forensic doctors, advocates and judges must recognise that, despite what they think and dictionaries say, the crowd can understand words very differently, and this can have consequences. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/brekkies-barbies-mozzies-why-do-aussies-shorten-so-many-words-192616">Brekkies, barbies, mozzies: why do Aussies shorten so many words?</a>
</strong>
</em>
</p>
<hr>
<img src="https://counter.theconversation.com/content/200635/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Professor Cordner was an expert witness at both Commissions of Inquiry into the convictions of Kathleen Folbigg. </span></em></p><p class="fine-print"><em><span>Kate Burridge does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>The meanings we carry around in our heads seem so natural and inborn that we fail to realise other people can have quite different understandings.Kate Burridge, Professor of Linguistics, Monash UniversityStephen Cordner, Senior Consultant/Professor Emeritus, Dept of Forensic Medicine, Monash University, Victorian Institute of Forensic MedicineLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/2108362023-09-28T12:28:47Z2023-09-28T12:28:47ZJuries that don’t understand forensic science can send innocent people to prison − a short training video could help<figure><img src="https://images.theconversation.com/files/550656/original/file-20230927-21-d5p74f.jpg?ixlib=rb-1.1.0&rect=928%2C0%2C7011%2C4916&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">Jurors tend to rely heavily on forensic testimony, even when they don't understand it.</span> <span class="attribution"><a class="source" href="https://www.gettyimages.com/detail/photo/witness-addressing-the-courtroom-in-a-trial-royalty-free-image/844393098">andresr/E+ via Getty Images</a></span></figcaption></figure><p><a href="https://www.law.umich.edu/special/exoneration/Pages/casedetail.aspx?caseid=5159">Ledura Watkins</a> was 19 years old when he was accused of murdering a public school teacher. At trial, a forensic expert testified that a single hair found at the scene was similar to Watkins’ and stated his conclusion was based on “reasonable scientific certainty.” He explained that he’d conducted thousands of hair analyses and “had never been wrong.”</p>
<p>This one hair was the only physical evidence tying Watkins to the crime. In 1976, Ledura Watkins was convicted of first-degree murder and sentenced to life in prison without the possibility of parole.</p>
<p>Here’s the catch: The expert’s testimony was inappropriate and misleading, and the jury made a mistake. Watkins was innocent. Ledura Watkins lost over 41 years of his life to a <a href="https://www.law.umich.edu/special/exoneration/Pages/casedetail.aspx?caseid=5159">wrongful conviction based on improper forensic testimony</a>.</p>
<p><a href="https://scholar.google.com/citations?user=wR9V8s8AAAAJ&hl=en&oi=sra">Our interdisciplinary</a> <a href="https://scholar.google.com/citations?user=syay8eEAAAAJ&hl=en&oi=ao">team of</a> <a href="https://scholar.google.com/citations?user=m9pMkQcAAAAJ&hl=en&oi=ao">legal psychologists</a>, <a href="https://gfjc.fiu.edu/">forensic experts</a> <a href="https://scholar.google.com/citations?user=STmVsAgAAAAJ&hl=en&oi=ao">and an attorney</a> worked to develop an educational tool to help jurors avoid making similar mistakes in the future.</p>
<h2>Forensic testimony carries weight with jurors</h2>
<p><a href="https://www.law.umich.edu/special/exoneration/Pages/ExonerationsContribFactorsByCrime.aspx">One out of every five wrongful convictions</a> cataloged through September 2023 by the <a href="https://www.law.umich.edu/special/exoneration/Pages/mission.aspx">National Registry of Exonerations</a> involved improper forensic evidence.</p>
<p>There is reason to be concerned about jurors’ ability to adequately evaluate forensic evidence. <a href="https://doi.org/10.1007/BF01498976">Jurors tend</a> <a href="https://doi.org/10.1111/j.1559-1816.1990.tb00400.x">to rely heavily</a> <a href="https://doi.org/10.1037/lhb0000423">on forensic evidence</a> <a href="https://doi.org/10.1037/1076-8971.14.1.27">when making decisions</a> in a case, <a href="https://doi.org/10.1023/A:1022368801333">despite struggling to</a> <a href="https://doi.org/10.1037/lhb0000027">understand the statistical analyses</a> <a href="https://doi.org/10.1086/428020">and language used</a> to explain forensic science. They might ignore the differences between appropriately worded forensic testimony <a href="https://doi.org/10.1037/lhb0000423">and testimony that violates best-practice guidelines</a>, fail to grasp the limitations of forensic science in expert witness testimony and <a href="https://doi.org/10.1007/s10979-008-9169-1">overly rely</a> <a href="https://doi.org/10.1037/law0000103">on an expert’s experience</a> when evaluating the evidence.</p>
<p>Despite all these issues, jurors remain <a href="https://doi.org/10.1007/s10979-008-9169-1">overconfident in their ability</a> to comprehend forensic testimony.</p>
<p>Researchers have long suggested that part of the problem is the <a href="https://doi.org/10.1037/lhb0000423">way forensic evidence is presented</a> in courtrooms. In response to <a href="https://www.jstor.org/stable/25475240">calls by scientists</a>, the U.S. Department of Justice approved the <a href="https://www.justice.gov/olp/uniform-language-testimony-and-reports">Uniform Language for Testimony and Reports</a> in 2018. These <a href="https://www.justice.gov/media/1072031/dl?inline">guidelines</a> aimed to lessen misleading statements in forensic testimony and outlined five statements forensic experts should not make. The expert in Ledura Watkins’ case made several of these statements, including claiming that his examination was perfect because of the number of examinations he had conducted.</p>
<p><iframe id="2I1CZ" class="tc-infographic-datawrapper" src="https://datawrapper.dwcdn.net/2I1CZ/2/" height="400px" width="100%" style="border: none" frameborder="0"></iframe></p>
<p>It’s understandable that jurors are swayed by an expert who uses terms like “error free,” “perfect” or “scientific certainty.” We are interested in finding ways to help people critically evaluate the forensic testimony they hear in court.</p>
<h2>An informational video for jurors</h2>
<p>Inspired by one court’s use of <a href="https://www.wawd.uscourts.gov/jury/unconscious-bias">videos to help train jurors</a> on relevant concepts, our team developed what we call the forensic science informational video. It’s about 4½ minutes long and focuses on latent print examinations, including fingerprints, footwear impressions and tire impressions.</p>
<p>In the FSI video, a narrator explains what a forensic expert is and how they might testify in court. The video describes how latent print examinations are conducted and what types of statements are appropriate – or not – for an expert to make in their testimony, based on the DOJ guidelines.</p>
<figure>
<iframe width="440" height="260" src="https://www.youtube.com/embed/fZJAlB9OgLA?wmode=transparent&start=0" frameborder="0" allowfullscreen=""></iframe>
<figcaption><span class="caption">Mock jurors watched this training video about forensic testimony.</span></figcaption>
</figure>
<p>In two different studies, we recruited jury-eligible adults to test whether our video had any effect on how jurors judged forensic testimony.</p>
<p>In our first study, some participants watched the FSI video and others didn’t. Participants who watched the FSI video were <a href="https://doi.org/10.1177/00938548231195112">more likely to give lower ratings to improper forensic testimony</a> and the forensic expert who gave it.</p>
<p>In our second study, we tested whether the video could help jurors <a href="https://doi.org/10.1037/lhb0000539">differentiate between low-quality and high-quality testimony</a> without creating a general distrust in forensic evidence. Participants watched a 45-minute mock trial video. Without training from the FSI video, participants rated both low- and high-quality forensic testimony highly. That is, they didn’t differentiate between testimony in which the expert violated three of the DOJ guidelines and testimony that followed the guidelines.</p>
<p>But participants who watched our informational video prior to the mock trial were more likely to differentiate between the low- and high-quality testimony, rating the expert giving low-quality testimony more poorly than the expert giving high-quality testimony.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/550657/original/file-20230927-25-w5o665.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="sign directing juror where to report for their service" src="https://images.theconversation.com/files/550657/original/file-20230927-25-w5o665.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/550657/original/file-20230927-25-w5o665.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=383&fit=crop&dpr=1 600w, https://images.theconversation.com/files/550657/original/file-20230927-25-w5o665.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=383&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/550657/original/file-20230927-25-w5o665.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=383&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/550657/original/file-20230927-25-w5o665.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=482&fit=crop&dpr=1 754w, https://images.theconversation.com/files/550657/original/file-20230927-25-w5o665.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=482&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/550657/original/file-20230927-25-w5o665.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=482&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">In-court instruction can provide everyday citizens with the knowledge they need to make good decisions.</span>
<span class="attribution"><a class="source" href="https://www.gettyimages.com/detail/news-photo/sign-detailing-instructions-for-jurors-lies-in-a-hallway-news-photo/57502325">Chip Somodevilla via Getty Images</a></span>
</figcaption>
</figure>
<h2>Training helps jurors assess forensic testimony</h2>
<p>These findings suggest that our informational video helped mock jurors in two ways. Participants learned how to identify low-quality forensic testimony and how to adjust their evaluations of the expert and their testimony accordingly. Importantly, the video did not cause participants to distrust latent print evidence in general.</p>
<p>Our study is a promising first step in exploring ways to help jurors understand complex forensic testimony. A brief video like ours can provide standardized information about forensic experts and types of appropriate and inappropriate testimony to jurors across courts, much like similar <a href="https://www.wawd.uscourts.gov/jury/unconscious-bias">videos about implicit bias</a> already being used in some courts.</p>
<p>We believe a training video has the potential to be easily implemented as an educational tool to improve the quality of jurors’ decision-making. A better understanding of the distinction between proper and improper testimony would improve the justice system by helping jurors fulfill their roles as objective fact-finders – and hopefully prevent wrongful convictions like that of Ledura Watkins.</p><img src="https://counter.theconversation.com/content/210836/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Devon LaBat receives funding from the National Institute of Justice. </span></em></p><p class="fine-print"><em><span>Deborah Goldfarb receives funding from the National Institute of Justice. </span></em></p><p class="fine-print"><em><span>Jacqueline R. Evans receives funding from the National Institute of Justice. </span></em></p><p class="fine-print"><em><span>Nadja Schreiber Compo received funding from the National Institute of Justice.</span></em></p>Educating mock jurors about what kinds of statements are appropriate − or not − led to more critical assessments of forensic testimony and improved the quality of their decisions.Devon LaBat, Doctoral Candidate in Legal Psychology, Florida International UniversityDeborah Goldfarb, Assistant Professor of Psychology, Florida International UniversityJacqueline R. Evans, Associate Professor of Psychology, Florida International UniversityNadja Schreiber Compo, Professor of Psychology, Florida International UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/2102312023-09-20T12:26:43Z2023-09-20T12:26:43ZYour unique body odor could identify who you are and provide insights into your health – all from the touch of a hand<figure><img src="https://images.theconversation.com/files/549153/original/file-20230919-31-na83ko.jpg?ixlib=rb-1.1.0&rect=0%2C0%2C2120%2C1414&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">The scent emitted from your hands could offer clues about who you are.</span> <span class="attribution"><a class="source" href="https://www.gettyimages.com/detail/photo/digital-composite-image-of-hand-amidst-geometric-royalty-free-image/1307462742">Siro Rodenas Cortes/Moment via Getty Images</a></span></figcaption></figure><p>From the aroma of fresh-cut grass to the smell of a loved one, you encounter scents in every part of your life. Not only are you constantly surrounded by odor, you’re also producing it. And it is so distinctive that it can be used to tell you apart from everyone around you.</p>
<p>Your scent is a complex product influenced by many factors, including your genetics. Researchers believe that a particular group of genes, the <a href="https://doi.org/10.1177/147470490700500206">major histocompatibility complex</a>, play a large role in scent production. These genes are involved in the body’s immune response and are believed to influence body odor by encoding the production of specific proteins and chemicals.</p>
<p>But your scent isn’t fixed once your body produces it. As sweat, oils and other secretions make it to the surface of your skin, <a href="https://asm.org/Articles/2021/December/Microbial-Origins-of-Body-Odor">microbes break down and transform</a> these compounds, changing and adding to the odors that make up your scent. This scent medley emanates from your body and settles into the environments around you. And it can be used to track, locate or identify a particular person, as well as distinguish between healthy and unhealthy people.</p>
<p><a href="https://scholar.google.com/citations?user=H4mfIRkAAAAJ&hl=en">We are</a> <a href="https://scholar.google.com/citations?user=H_xIriMAAAAJ&hl=en">researchers who</a> <a href="https://scholar.google.com/citations?user=JgBnpdkAAAAJ&hl=en">specialize in</a> studying human scent through the detection and characterization of gaseous chemicals called <a href="https://doi.org/10.1111%2Fj.1365-2133.2008.08748.x">volatile organic compounds</a>. These gases can relay an abundance of information for both forensic researchers and health care providers.</p>
<figure>
<iframe width="440" height="260" src="https://www.youtube.com/embed/wkNOwOTvAxw?wmode=transparent&start=0" frameborder="0" allowfullscreen=""></iframe>
<figcaption><span class="caption">Human scent analysis breaks down body odor to its individual components.</span></figcaption>
</figure>
<h2>Science of body odor</h2>
<p>When you are near another person, you can feel their body heat without touching them. You may even be able to smell them without getting very close. The natural warmth of the human body creates a temperature differential with the air around it. You warm up the air nearest to you, while air that’s farther away remains cool, creating <a href="https://doi.org/10.1111/j.1556-4029.2009.01236.x">warm currents of air</a> that surround your body. </p>
<p>Researchers believe that this plume of air helps disperse your scent by pushing the millions of skin cells you shed over the course of a day off your body and into the environment. These skin cells <a href="https://doi.org/10.1007/978-0-387-73003-5_279">act as boats or rafts</a> carrying glandular secretions and your resident microbes – a combination of ingredients that emit your scent – and depositing them in your surroundings.</p>
<p>Your scent is composed of the volatile organic compounds present in the <a href="https://doi.org/10.1007/s10886-005-5801-4">gases emitted from your skin</a>. These gases are the combination of sweat, oils and trace elements exuded from the glands in your skin. The primary components of your odor depend on internal factors such as your race, ethnicity, biological sex and other traits. Secondary components waver based on factors like stress, diet and illness. And tertiary components from external sources like perfumes and soaps build on top of your distinguishable odor profile.</p>
<h2>Identity of scent</h2>
<p>With so many factors influencing the scent of any given person, your body odor can be used as an identifying feature. <a href="https://doi.org/10.1007/978-0-387-73003-5_279">Scent detection canines</a> searching for a suspect can look past all the other odors they encounter to follow a scent trail left behind by the person they are pursuing. This practice relies on the assumption that each person’s scent is distinct enough that it can be distinguished from other people’s.</p>
<p>Researchers have been studying the discriminating potential of human scent for over three decades. A 1988 experiment demonstrated that a dog could distinguish <a href="https://doi.org/10.1068/p170549">identical twins living apart</a> and exposed to different environmental conditions by their scent alone. This is a feat that could not be accomplished using DNA evidence, as identical twins share the same genetic code.</p>
<p>The field of human scent analysis has expanded over the years to further study the composition of human scent and how it can be used as a form of forensic evidence. Researchers have seen differences in human odor composition that can be classified based on sex, gender, race and ethnicity. Our research team’s 2017 study of 105 participants found that <a href="https://doi.org/10.1016/j.forsciint.2016.09.011">specific combinations</a> of 15 volatile organic compounds collected from people’s hands could distinguish between race and ethnicity with an accuracy of 72% for whites, 82% for East Asians and 67% for Hispanics. Based on a combination of 13 compounds, participants could be distinguished as male or female with an overall 80% accuracy.</p>
<figure>
<iframe width="440" height="260" src="https://www.youtube.com/embed/HaJAwi8kSLU?wmode=transparent&start=0" frameborder="0" allowfullscreen=""></iframe>
<figcaption><span class="caption">Researchers have trained dogs to sniff out COVID-19 infections.</span></figcaption>
</figure>
<p>Researchers are also producing models to predict the characteristics of a person based on their scent. From a sample pool of 30 women and 30 men, our team built a <a href="https://doi.org/10.1371/journal.pone.0286452">machine learning model</a> that could predict a person’s biological sex with 96% accuracy based on hand odor.</p>
<h2>Scent of health</h2>
<p>Odor research continues to provide insights into illnesses. Well-known examples of using scent in medical assessments include <a href="https://theconversation.com/doctor-dog-how-our-canine-companions-can-help-us-detect-covid-and-other-diseases-204603">seizure and diabetic alert canines</a>. These dogs can give their handlers time to prepare for an impending seizure or notify them when they need to adjust their blood glucose levels.</p>
<p>While these canines often work with a single patient known to have a condition that requires close monitoring, medical detection dogs can also indicate whether someone is ill. For example, researchers have shown that dogs can be trained to <a href="https://theconversation.com/the-scent-of-sickness-5-questions-answered-about-using-dogs-and-mice-and-ferrets-to-detect-disease-151832">detect cancer</a> in people. Canines have also been trained to <a href="https://theconversation.com/dogs-can-be-trained-to-sniff-out-covid-19-a-team-of-forensic-researchers-explain-the-science-169012">detect COVID-19 infections</a> at a 90% accuracy rate.</p>
<p>Similarly, our research team found that a laboratory analysis of <a href="https://doi.org/10.3390/diagnostics13040707">hand odor samples</a> could discriminate between people who are COVID-19 positive or negative with 75% accuracy.</p>
<h2>Forensics of scent</h2>
<p>Human scent offers a noninvasive method to collect samples. While direct contact with a surface like touching a doorknob or wearing a sweater provides a clear route for your scent to transfer to that surface, simply standing still will also transfer your odor into the surrounding area.</p>
<p>Although human scent has the potential to be a critical form of forensic evidence, it is still a developing field. Imagine a law enforcement officer collecting a scent sample from a crime scene in hopes that it may match with a suspect. </p>
<p>Further research into human scent analysis can help fill the gaps in our understanding of the individuality of human scent and how to apply this information in forensic and biomedical labs.</p><img src="https://counter.theconversation.com/content/210231/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Dr. Kenneth G. Furton has consulted for and owns shares with VOC Health, Inc. He has received funding from the Netherlands National Police, the U.S. Department of Defense, the Federal Bureau of Investigation, Colgate-Palmolive, and the National Institutes of Health.
</span></em></p><p class="fine-print"><em><span>Dr. Vidia Gokool formerly of Florida International University, is currently an employee of the Department of Energy. The writing and preparation of this work was in part performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.</span></em></p><p class="fine-print"><em><span>Chantrell Frazier does not work for, consult, own shares in or receive funding from any company or organization that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>Human scent could one day be used as evidence in forensics and as diagnostic information in medicine.Chantrell Frazier, Assistant Professor of Chemistry and Food Science, Framingham State UniversityKenneth G. Furton, Professor of Chemistry and Biochemistry, Florida International UniversityVidia A. Gokool, Postdoctoral Researcher, Lawrence Livermore National LaboratoryLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/2117992023-08-24T14:51:27Z2023-08-24T14:51:27ZNew research reveals that Ötzi the iceman was bald and probably from a farming family – what else can DNA uncover?<p>In 1991, hikers came across a body that <a href="https://www.iceman.it/en/the-discovery/">was partially contained in ice</a> high up in the Alpine province of South Tyrol, Italy. Initially thought to be from a recent death, the body was later discovered to be 5,300 years old – from a time known as <a href="https://en.wikipedia.org/wiki/Chalcolithic">the Copper Age</a>.</p>
<p>This amazing find would subsequently become known as Ötzi the iceman. His body and belongings were extensively studied, prompting numerous questions: what was he doing here? Where was he from? How did he live – and die?</p>
<p>Researchers from the Max Planck Institute for Evolutionary Anthropology in Germany have just added another piece to this jigsaw, <a href="https://www.cell.com/cell-genomics/pdfExtended/S2666-979X(23)00174-X">describing the physical appearance of Ötzi</a> based on new DNA information. They say he probably had relatively dark skin and was balding. But how reliable are these predictions and could they be used in forensics?</p>
<p>Much of this depends on the quality of the samples. Ötzi died in the Otzal Alps and was frozen almost immediately, remaining in the permafrost until discovery.</p>
<p><a href="https://www.iceman.it/en/the-iceman/">The body is currently stored in low temperature conditions</a> at the South Tyrol Museum of Archaeology. His unique preservation enabled the sequencing of Ötzi’s whole genome – the complete “instruction booklet” for building a human. The chemical building blocks of DNA are called bases. These are nitrogen-containing chemical compounds called adenine, thymine, cytosine and guanine, known by the letters A, T, C and G. The human genome consists of billions of these bases arranged in different sequences - making up the genetic code.</p>
<p>Much of the genome’s DNA sequence is common to all humans, but there are places where a change from one base to another results in changes to our physical appearance. </p>
<p>The Ötzi paper isn’t the first study that has tried to predict a person’s appearance from ancient remains. King Richard III was killed in the Battle of Bosworth in 1485. When his body was discovered in 2012, under a car park in Leicester, only his bones remained. But it was enough for a team led by Turi King at the University of Leicester to extract <a href="https://www.nature.com/articles/ncomms6631">fragments of DNA from them</a>.</p>
<figure class="align-center ">
<img alt="Representation of the DNA molecule." src="https://images.theconversation.com/files/544058/original/file-20230822-21-xnyapv.jpg?ixlib=rb-1.1.0&rect=14%2C0%2C4947%2C2799&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/544058/original/file-20230822-21-xnyapv.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=337&fit=crop&dpr=1 600w, https://images.theconversation.com/files/544058/original/file-20230822-21-xnyapv.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=337&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/544058/original/file-20230822-21-xnyapv.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=337&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/544058/original/file-20230822-21-xnyapv.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=424&fit=crop&dpr=1 754w, https://images.theconversation.com/files/544058/original/file-20230822-21-xnyapv.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=424&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/544058/original/file-20230822-21-xnyapv.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=424&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Representation of the DNA molecule.</span>
<span class="attribution"><a class="source" href="https://www.shutterstock.com/image-photo/blue-helix-human-dna-structure-1669326868">Billion Photos / Shutterstock</a></span>
</figcaption>
</figure>
<h2>Crime scene samples</h2>
<p>These fragments, comprising hundreds of DNA bases, were sequenced. They were able to predict his hair and eye colour and he was reliably matched to a living relative – assigning a clear identity to the remains. This means that if I ate an apple and threw the core away, I could also be identified by the DNA I left on the core. </p>
<p>Sequencing a genome, which comprises billions of DNA bases, enables scientists to evaluate regions of the human genome that contribute to appearance. These are known as highly variable regions.</p>
<p>For more than 30 years, forensic scientists have looked at specific highly variable regions in DNA to match these to crime scene samples, or to relatives of a suspect or victim. So how likely is it that DNA from such a sample could accurately paint a picture of me? </p>
<p>Let’s take facial shape. Can forensic scientists build a kind of identikit photo from a crime scene DNA sample? Some efforts have <a href="https://snapshot.parabon-nanolabs.com/">already been taken in this regard</a>. But our understanding of the gene variants involved in face shape are incomplete. </p>
<p>Many of the identikit pictures built from DNA analysis alone <a href="https://snapshot.parabon-nanolabs.com/posters">bear a resemblance</a> to actual images of the individuals. But when DNA is the only evidence available to build a portrait, the prediction of facial appearance can be skewed by body composition which is significantly affected by diet and lifestyle.</p>
<p>However, other aspects of appearance can be predicted with high accuracy: red hair, for example. Base variations in the <a href="https://onlinelibrary.wiley.com/doi/epdf/10.1002/humu.20476">melanocortin receptor 1 (MC1R) gene</a> are linked to red hair, fair skin and freckling. In rarer cases, variations in two other genes <a href="https://www.snpedia.com/index.php/Rs12913832">HERC2</a> and <a href="https://www.snpedia.com/index.php/Rs2378249">PIGU/ASIP</a> are also linked to red hair.</p>
<p>The human genome is packaged into 23 pairs of chromosomes. On chromosome 15 there are many regions which influence eye colour and skin pigmentation. Eye colour can be reliably predicted, with blue eye colour the most accurate. Hair colour can be predicted from DNA, but <a href="https://www.sciencedirect.com/science/article/pii/S1872497312001810">darker shades of hair are more accurately predicted</a> than blonde hair. </p>
<p>Aside from the complications posed by hair dye, predicting blonde hair is complicated because some individuals have very blonde hair in childhood that darkens to light brown with the onset of adulthood. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/how-does-genetics-explain-non-identical-identical-twins-55479">How does genetics explain non-identical identical twins?</a>
</strong>
</em>
</p>
<hr>
<h2>Environmental factors</h2>
<p>Several genes contribute to produce hair pigments and a spectrum of hair colour is seen in humans, ranging from light blonde to black. <a href="https://www.sciencedirect.com/science/article/pii/S1872497312001810">Commercially sold laboratory kits such as Hirisplex</a> can simultaneously evaluate several DNA regions to predict the hair and eye colour from a biological sample. However, unlike eye colour, hair colour prediction from DNA is only of value until midlife, when the natural processes of ageing lead to greying or white hair. </p>
<p>These processes also lead to hair loss in some people and more than 300 gene variants have been linked to baldness. Future research should determine more clearly how these gene variants affect hair density. However, stress, diet, medication, and disease, in addition to genetics, all influence hair loss. </p>
<p>Individual DNA bases can become chemically modified as we age. This is known as an epigenetic change. Identical twins start life with the same DNA, but as they age, some physical differences become apparent.</p>
<p>Some of those differences are <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4276927/">due to DNA bases changing</a> as cells divide but most are due to base changes caused by lifestyle and the environment. This is an exciting area of research for understanding ageing and disease. It can also be used as a forensic tool to distinguish between twins.</p>
<p>There is currently a lot of DNA information from people of European origin, but fewer whole genomes exist from populations elsewhere. This can influence the accuracy when scientists try to predict both appearance and ancestry.</p>
<p>More representative data from the rest of the world will therefore enhance studies in forensic archaeology, such as the Ötzi research. It will also have implications for forensics and assist in the identification of missing individuals.</p><img src="https://counter.theconversation.com/content/211799/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Caroline Smith does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>We can predict hair and eye colour with reasonable accuracy from DNA, but other characteristics are being investigated.Caroline Smith, Assistant Head, School of Life Sciences, University of WestminsterLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/2074182023-07-30T20:08:31Z2023-07-30T20:08:31ZSecrets wrapped in fabric: how our study of 100 decomposing piglet bodies will help solve criminal cases<figure><img src="https://images.theconversation.com/files/539908/original/file-20230728-23-ku5ia8.jpeg?ixlib=rb-1.1.0&rect=19%2C3%2C1274%2C857&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">
</span> <span class="attribution"><span class="source">Photo by Stevie Ziogos</span>, <span class="license">Author provided</span></span></figcaption></figure><p>Until the <a href="https://www.sciencedirect.com/science/article/pii/B9780081018729000042">late 19th century</a>, the success of criminal investigations largely hung on witness reports and (often extorted) confessions. A lack of scientific tools meant investigators needed advanced <a href="https://www.sciencedirect.com/topics/psychology/deductive-reasoning">deductive reasoning</a> abilities – and even then they’d often hit a dead end.</p>
<p>Today, investigations demand an interdisciplinary and <a href="https://link.springer.com/article/10.1007/s00414-022-02846-6">high-tech</a> approach, involving experts from diverse scientific disciplines. Stabbing investigations are particularly important, as fatal stabbings are the leading cause of homicide in countries with restricted access to firearms, including <a href="https://www.aic.gov.au/sites/default/files/2020-05/tbp045.pdf">Australia</a>.</p>
<p>Carefully interpreting <a href="https://theconversation.com/the-camera-never-lies-our-research-found-cctv-isnt-always-dependable-when-it-comes-to-murder-investigations-199828">CCTV footage</a> can be useful, but sometimes the crime scene won’t have surveillance cameras. The victim’s body may be discovered days, weeks, or months after the event. By then it may be partially consumed by insects – or rain may have washed away the blood stains, or potentially even the murder weapon.</p>
<p>In such a case, analysing damage to a <a href="https://www.ojp.gov/ncjrs/virtual-library/abstracts/comparing-alleged-weapon-damage-clothing-value-multiple-layers-and">victim’s clothing</a> can provide crucial insight. But how does clothing on a decomposing body react to environmental and biological factors?</p>
<p>This was our question as we conducted research using the decomposing bodies of more than 100 stillborn piglets. Our findings from this <a href="https://www.mdpi.com/2075-4450/14/7/618">first-of-its-kind experiment</a> could help investigators solve future (and past) crimes in which stabs, tears or other damages to clothing are in question.</p>
<h2>Pigs wrapped in fabric</h2>
<p><a href="https://www.sciencedirect.com/science/article/pii/S1355030618301680">Textile analysis</a> has a significant role in forensic investigation. Clothes can preserve crucial information about the events leading up to someone’s death. Evidence might come in the form of fibres under a victim’s fingernails, <a href="https://www.pnas.org/doi/10.1073/pnas.1917222117">tears in the clothing</a> resulting from movement or traction, or cuts and holes caused by weapons. </p>
<p>However, the decomposition process itself will also alter the fabric and existing damages. It may even introduce new damages that complicate the analysis.</p>
<p>To understand how clothing might change throughout this process, we conducted an experiment in the summer heat of Western Australia. We used more than 100 stillborn piglets (simulating human remains) wrapped in common fabrics including cotton, stretchy synthetic material, and a fabric blend. Some piglets were left unclothed as control samples.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/539902/original/file-20230728-25-grpb0x.JPG?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/539902/original/file-20230728-25-grpb0x.JPG?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/539902/original/file-20230728-25-grpb0x.JPG?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=450&fit=crop&dpr=1 600w, https://images.theconversation.com/files/539902/original/file-20230728-25-grpb0x.JPG?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=450&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/539902/original/file-20230728-25-grpb0x.JPG?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=450&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/539902/original/file-20230728-25-grpb0x.JPG?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=566&fit=crop&dpr=1 754w, https://images.theconversation.com/files/539902/original/file-20230728-25-grpb0x.JPG?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=566&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/539902/original/file-20230728-25-grpb0x.JPG?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=566&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">The experiment was conducted at a facility in Western Australia.</span>
<span class="attribution"><a class="source" href="https://www.mdpi.com/2075-4450/14/7/618">Photo by Stevie Ziogos</a>, <span class="license">Author provided</span></span>
</figcaption>
</figure>
<p>We intentionally inflicted cuts and tears on most of the fabrics, before leaving the carcasses to decompose naturally in a bushland environment until only bones remained. The bodies were shielded from <a href="https://pubmed.ncbi.nlm.nih.gov/20171028/">large scavengers</a>, but not from <a href="https://pubmed.ncbi.nlm.nih.gov/19836175/">carrion insects</a>. </p>
<p>While previous research has explored the impact <a href="https://pubmed.ncbi.nlm.nih.gov/21602003/">of clothing on decomposition</a>, we were focused on the other side of the coin: how do insects impact the fabric on a decomposing carcass? And in what ways could this jeopardise an investigation? </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/flies-maggots-and-methamphetamine-how-insects-can-reveal-drugs-and-poisons-at-crime-scenes-176981">Flies, maggots and methamphetamine: how insects can reveal drugs and poisons at crime scenes</a>
</strong>
</em>
</p>
<hr>
<h2>Exposed to natural elements</h2>
<p>It wasn’t long before the fabrics started to transform due to exposure to bacteria, fungi, insects and other environmental factors. </p>
<p>They changed in shape and texture, and became stretched as a result of the natural bloating of the carcasses. Less than a week after the carcasses were placed, new holes appeared in the fabric – especially in cotton – as the fibres broke down.</p>
<p>There were also chemical changes due to potential exposure to body fluids and the chemical products of bacteria and fungi.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/539897/original/file-20230728-27-48r2yd.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/539897/original/file-20230728-27-48r2yd.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/539897/original/file-20230728-27-48r2yd.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/539897/original/file-20230728-27-48r2yd.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/539897/original/file-20230728-27-48r2yd.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/539897/original/file-20230728-27-48r2yd.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=502&fit=crop&dpr=1 754w, https://images.theconversation.com/files/539897/original/file-20230728-27-48r2yd.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=502&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/539897/original/file-20230728-27-48r2yd.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=502&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Experimental fabrics observed with a ‘scanning electron microscope’ (SEM) showed fungal colonisation.</span>
<span class="attribution"><a class="source" href="https://www.mdpi.com/2075-4450/14/7/618">Photo by Stevie Ziogos</a>, <span class="license">Author provided</span></span>
</figcaption>
</figure>
<p>Insects were particularly active in areas where body fluids were present. Of twenty insect groups collected and identified, blowflies and carrion beetles were the most common antagonists. </p>
<p>Throughout the 47 days of the experiment, we managed to collect a range of data on fabric degradation throughout the decomposition process. It’s the first time this has been documented in such detail in a controlled experiment. </p>
<figure class="align-center ">
<img alt="" src="https://images.theconversation.com/files/539893/original/file-20230728-19-9x88ao.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/539893/original/file-20230728-19-9x88ao.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=401&fit=crop&dpr=1 600w, https://images.theconversation.com/files/539893/original/file-20230728-19-9x88ao.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=401&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/539893/original/file-20230728-19-9x88ao.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=401&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/539893/original/file-20230728-19-9x88ao.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=504&fit=crop&dpr=1 754w, https://images.theconversation.com/files/539893/original/file-20230728-19-9x88ao.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=504&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/539893/original/file-20230728-19-9x88ao.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=504&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Insects visited the bloodstains of the fabric during the early stages of the experiment.</span>
<span class="attribution"><span class="source">Photo by Stevie Ziogos, Author provided</span></span>
</figcaption>
</figure>
<h2>New tools to solve new (and old) mysteries</h2>
<p>Although textile damage analysis is vital for forensics, there has been limited research on how it overlaps with forensic entomology and taphonomy (the study of how organisms decompose). Our research shows fabrics can hold significant evidence, and this evidence changes as bodies decompose while being exposed to the environment.</p>
<p>There are myriad examples of crimes where evidence related to clothing has been crucial to solving the case. </p>
<p>In the 1980 <a href="https://www.injustice.law/2021/07/05/the-shameful-tale-of-what-happened-to-lindy-chamberlain/">Chamberlain case</a>, a jury wrongly found Lindy Chamberlain and her husband Michael guilty of murdering their nine-week-old daughter Azaria, who had disappeared. </p>
<p>It was only when Azaria’s clothing was recovered a week after her disappearance that investigators had evidence of a dingo having snatched her (as the clothes showed signs of having been dragged through sand). The Chamberlains were exonerated as a result.</p>
<p>More recently, a person of interest was arrested in New York as the “<a href="https://7news.com.au/news/crime/architect-charged-over-murders-after-pizza-crust-leads-to-craigslist-ripper-breakthrough-c-11284691">Craigslist ripper</a>”, a serial killer responsible for the murder of more than ten people. Investigators obtained DNA evidence from strands of hair found in <a href="https://www.smh.com.au/world/hunt-for-ripper-as-new-york-beach-body-count-mounts-20111202-1obc7.html">burlap sacks</a> used to hide and transport the bodies. </p>
<p>Although many details of this particular case remain undisclosed, such investigations will most likely use insect-related evidence and other trace evidence on textiles to help make important inferences, including about time of death.</p>
<p>More generally, our work will help investigators avoid misinterpreting evidence from clothing. For instance, if investigators aren’t aware holes in fabric can form through exposure to insects and natural elements, they might incorrectly attribute them to an animal or human attacker. </p>
<p>Similarly, by gauging which portion of clothing has the most insect damage, they might be able to understand where the most fluid was present on the body (if it’s found as skeletal remains). This could help them figure out where and how damage was inflicted.</p>
<p>This year we published <a href="https://pubmed.ncbi.nlm.nih.gov/37367352/">guidelines</a> to help other forensic professionals in the process of observing and collecting insects at a crime scene, and in considering how insect activity may be connected with a victim’s clothing. We hope our work can help future investigations, and maybe even reopen some cold cases.</p><img src="https://counter.theconversation.com/content/207418/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>This research has been conducted in collaboration with Stevie Ziogos (PhD candidate, Murdoch University) and Kari Pitts (ChemCentre). Forensic entomology guidelines have been updated in collaboration with Tharindu Bambaradeniya (PhD candidate, Murdoch University).</span></em></p><p class="fine-print"><em><span>Ian Dadour does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>Fatal stabbings are the leading cause of homicide in countries with restricted access to firearms, including Australia. New research could help solve these cases.Paola A. Magni, Senior Lecturer in Forensic Science, Murdoch UniversityIan Dadour, Adjunct professor, Murdoch UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/2084642023-06-27T06:06:16Z2023-06-27T06:06:16ZThe Titan disaster investigation has begun. An expert explains what might happen next<p>The United States Coast Guard is now <a href="https://edition.cnn.com/2023/06/26/us/submersible-titanic-implosion-deaths-monday/index.html">leading the investigation</a> into the Titan submersible, looking for answers about why it imploded, and what actions should be taken next.</p>
<p>A multinational search for the Titan came to a halt on Thursday, when a remotely operated vehicle (ROV) found five pieces of debris sprawled across the seabed, some 500 metres from the Titanic shipwreck. The vessel experienced a catastrophic implosion at some point during its journey, with all five passengers presumed dead. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/what-was-the-catastrophic-implosion-of-the-titan-submersible-an-expert-explains-208359">What was the 'catastrophic implosion' of the Titan submersible? An expert explains</a>
</strong>
</em>
</p>
<hr>
<p>For now, details elude us – and it could be days, or even weeks, before we receive meaningful updates on the investigation’s progress. Similar past events, such as the 2019 <a href="https://www.nytimes.com/2020/04/20/world/europe/russian-submarine-fire-losharik.html">fire in the Russian submarine Losharik</a>, have shown how sensitively the details of such investigations should be treated. </p>
<p>The Titan disaster happened in international waters, in a commercially operated vessel, and with victims of different nationalities. Officials will likely want to be certain about any details released – and some may not be disclosed at all.</p>
<h2>What happens next?</h2>
<p>The Titan, a research and exploration sub <a href="https://podcasts.apple.com/us/podcast/stockton-rush-manned-submersibles-science-exploration/id1515818448?i=1000493347762">owned by US company OceanGate</a>, lost contact with its surface vessel on Sunday morning, about one hour and 45 minutes after its departure.</p>
<p>Chief investigator Jason Neubauer said the US Coast Guard will receive help from Canada, France and the United Kingdom. He said authorities had already mapped the accident site, and the inquiry will aim to address several questions, including:</p>
<ul>
<li>what may have happened to cause the implosion?</li>
<li>how can safety be improved for future submersible voyages?</li>
<li>what civil or criminal charges should be laid in relation to the events, if any?</li>
</ul>
<p>Recovery operations in remote parts of the ocean are painstakingly complex, with myriad variables to consider. We can expect the Titan investigation will <a href="https://www.nytimes.com/2023/06/22/us/titanic-submersible-search-rescue-costs.html">cost millions of dollars</a>.</p>
<h2>Harsh conditions</h2>
<p>The investigation is being carried out at depths of about 3,800m, some 600km from the nearest coastline. The same vessel that identified the initial debris – a deep-sea ROV called <a href="https://pelagic-services.com/web2/index.php/odysseus-rov-system/">Odysseus 6K</a> – is <a href="https://www.cbc.ca/news/canada/newfoundland-labrador/titan-submerisble-investigation-1.6889066">reportedly also being used</a> to look for the vessel’s remaining parts. </p>
<p>Manufacturer Pelagic Research Services <a href="https://edition.cnn.com/2023/06/26/us/submersible-titanic-implosion-deaths-monday/index.html">told CNN</a> the ROV’s lifting capabilities had “been utilised and continue to be utilised”, and that missions would continue for about a week. However, we don’t know whether any debris has been recovered yet.</p>
<p>ROVs can collect vast amounts of data for deep-sea operations, including video footage and sensor readings. Ideally, an ROV will be able to reliably and quickly transmit data back to a support vessel or onshore facility, since real-time data transfer is often needed to make important decisions on the fly. </p>
<p>That said, even if Odysseus 6K delivers on this, some parts of the Titan may never be found. They may have disintegrated during the implosion, drifted too far away from the search area, or be obscured by other debris. </p>
<p>Underwater hazards, harsh weather and strong currents all add to the challenge – especially by <a href="https://pubmed.ncbi.nlm.nih.gov/37249969/">limiting visibility</a>. In the deep ocean, turbidity (haziness) and the absence of natural light means visibility is close to zero. Here, only sonar technology (which uses sound waves) may be used for navigation, mapping and locating objects of interest.</p>
<p>Any debris recovered will undoubtedly be valuable. Debris is physical evidence of the implosion, so analysing it will provide information (such as damage patterns and fractures) that can be used to infer the source of the implosion and the forces involved. </p>
<p>Experts can also conduct chemical analyses of the residue on the wreckage. However, this is affected by seawater, so a prompt recovery will be important.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/an-expert-explains-what-safety-features-a-submersible-should-have-208187">An expert explains what safety features a submersible should have</a>
</strong>
</em>
</p>
<hr>
<p>The Titan’s remote location means investigators won’t have the luxury of having the quick support offered by coastal rescue stations that can rapidly deploy search and rescue assets and diving teams. </p>
<p>They’ll have to rely on specialised resources, such as large vessels and aircraft with extended range capabilities. Aircraft can provide an elevated platform for visual observation and aerial mapping, as well as remote sensing technologies including radar systems and thermal imaging sensors. </p>
<h2>Finding the remains</h2>
<p>Chief investigator Neubauer has said <a href="https://www.bbc.com/news/66015811">searching for victims’</a> remains is on the agenda. But the chances of actually finding them will depend on various factors, including the cause of the implosion, the depth at which it happened, and the surrounding conditions. </p>
<p>A severe implosion may have resulted in extensive fragmentation and scattering of both the submersible’s structure and human remains. Remains can be swept away in currents, or tampered with by marine life.</p>
<p>They also behave differently depending on whether they’re recovered from <a href="https://www.proquest.com/openview/a65eb1a2d459fb92ea04605ef098497a/1.pdf?pq-origsite=gscholar&cbl=47323">non-sequestered environments</a> (exposed in the water) or <a href="https://pubmed.ncbi.nlm.nih.gov/23232544/">sequestered environments</a> (enclosed in a vessel). In the former scenario, bodies are often <a href="https://pubmed.ncbi.nlm.nih.gov/15166773/">consumed by animals</a> and decomposition causes <a href="https://www.semanticscholar.org/paper/Disappearance-of-soft-tissue-and-the-of-human-from-Haglund/5f5ec4ccf2ebabce7b9bd3106df77a4f78ecf1db">disarticulation</a>, wherein the bones gradually separate at the joints. However, garments can sometimes help to <a href="https://thehill.com/changing-america/well-being/569067-doctor-explains-why-21-human-feet-in-sneakers-may-have-washed-on/">keep things together</a>.</p>
<p>The effort to locate remains may involve observation from long-range aircraft and patrol vessels, or may even rely on radar, sonar or satellite imagery. If remains are located deep underwater, recovering them may involve using a specialised hoisting system designed to handle the challenges of a deep-sea environment.</p>
<h2>Sharing responsibility</h2>
<p>The Titan investigation will involve coordination between multiple entities, including maritime authorities, coast guard services and search and rescue organisations. </p>
<p>It will be subject to international agreements such as the <a href="https://www.imo.org/en/About/Conventions/Pages/International-Convention-on-Maritime-Search-and-Rescue-(SAR).aspx">International Convention on Maritime Search and Rescue</a>, as well as international law such as
the <a href="https://onboard.sosmediterranee.org/knowledge-base/article-98-duty-to-render-assistance/#">duty to render assistance</a>, which is enshrined in the United Nations Convention on the Law of the Sea. This requires that all vessels, regardless of their flag, have a legal obligation to render assistance to any person in distress at sea.</p>
<p>For now, we can only speculate on what the Titan investigation might produce. All we can do is wait, and hope that whatever answers do emerge will be put to good use to make sure something like this never happens again. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/why-is-extreme-frontier-travel-booming-despite-the-risks-208201">Why is extreme 'frontier travel' booming despite the risks?</a>
</strong>
</em>
</p>
<hr>
<img src="https://counter.theconversation.com/content/208464/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Paola A. Magni does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>The Titan disaster happened in international waters, in a commercially operated vessel, and with victims of different nationalities. Any details that emerge will likely be treated with sensitivity.Paola A. Magni, Senior Lecturer in Forensic Science, Murdoch UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/2056452023-06-05T05:55:18Z2023-06-05T05:55:18ZKathleen Folbigg pardon shows Australia needs a dedicated body to investigate wrongful convictions<p>The New South Wales Attorney-General Michael Daley today announced Kathleen Folbigg <a href="https://www.abc.net.au/news/2023-06-05/kathleen-folbigg-attorney-general-provides-update/102440136">has been pardoned</a> after having served 20 years for the murder of three of her infant children and the manslaughter of a fourth child. She has already been released, and won’t serve the rest of her 30-year sentence.</p>
<p>Daley had seen the preliminary findings of a second judicial inquiry led by former NSW Chief Justice Thomas Bathurst, which found there was reasonable doubt as to Folbigg’s guilt for each of the offences.</p>
<p>At trial, the prosecution had relied on the statistical improbability of so many of her children dying accidentally. However, at the second inquiry, this reasoning was called into question by fresh scientific evidence pointing to possible medical causes of the deaths.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/kathleen-folbiggs-children-likely-died-of-natural-causes-not-murder-heres-the-evidence-my-team-found-156487">Kathleen Folbigg's children likely died of natural causes, not murder. Here's the evidence my team found</a>
</strong>
</em>
</p>
<hr>
<p>Her two daughters were found to have a <a href="https://theconversation.com/kathleen-folbiggs-children-likely-died-of-natural-causes-not-murder-heres-the-evidence-my-team-found-156487">mutation in the CALM2 gene</a>, which is associated with sudden infant death.</p>
<p>One of her sons may have had an underlying neurological condition such as <a href="https://theconversation.com/kathleen-folbiggs-children-likely-died-of-natural-causes-not-murder-heres-the-evidence-my-team-found-156487">epilepsy</a>, which may have caused his death.</p>
<p>In relation to the death of her other son, Bathurst said the new medical evidence regarding the other three deaths undermined some of the reasoning used in the case against her. He <a href="https://www.theguardian.com/australia-news/2023/jun/05/kathleen-folbigg-pardoned-after-20-years-in-jail-over-deaths-of-her-four-children">said</a> “the coincidence and tendency evidence which was central to the (2003) Crown case falls away”.</p>
<p>At trial, and in the first inquiry, the prosecution had argued Folbigg’s diary entries relating to the deaths of her children could be interpreted as admissions of guilt. But having been presented with <a href="https://www.smh.com.au/national/nsw/folbigg-diaries-do-not-contain-true-expressions-of-guilt-inquiry-told-20230222-p5cmgc.html">fresh psychological evidence</a>, Bathurst <a href="https://www.news.com.au/national/nsw-act/crime/kathleen-folbiggs-diaries-reveal-she-didnt-kill-her-children/news-story/32d1958dd4890377761f2e35cb3fbd5d">interpreted</a> the diary entries as “the writings of a grieving and possibly depressed mother, blaming herself for the death of each child”.</p>
<p>Whereas at trial Folbigg had been presented by the prosecution <a href="https://www.bbc.com/news/world-australia-56355695">as</a> “Australia’s worst female serial killer”, Bathurst <a href="https://www.theguardian.com/australia-news/2023/jun/05/kathleen-folbigg-pardoned-after-20-years-in-jail-over-deaths-of-her-four-children">indicated</a> he was “unable to accept […] the proposition that Ms Folbigg was anything but a caring mother for her children”.</p>
<p>The Folbigg case is a particularly tragic case, but it’s not unprecedented. The criminal justice system carries an inbuilt risk of wrongful conviction. Ad hoc commissions of inquiries like the Folbigg inquiry are inefficient and expensive. The system needs reform. </p>
<p>The Folbigg case is yet another demonstration that Australia needs a Criminal Cases Review Commission (CCRC) – a statutory body working at arm’s length to investigate claims of wrongful conviction.</p>
<p>A CCRC would have the powers and resources to investigate defendants’ claims to have been wrongfully convicted. Claims found to have substance can be referred back to the court of criminal appeal. Standing CCRCs have proven to bring a <a href="https://www.gov.uk/government/publications/tailored-review-of-the-criminal-cases-review-commission">cost-effective improvement</a> to the accuracy of criminal justice systems overseas. </p>
<p>Preferably, it would be a single federal body covering all jurisdictions, or failing that, one for each jurisdiction.</p>
<h2>Wrongful convictions</h2>
<p>Cases where miscarriages of justice are identified years later, such as Folbigg’s, do happen.</p>
<p>In the last decade, Jason Roberts in Victoria <a href="https://www.theguardian.com/australia-news/2022/jul/11/jason-roberts-found-not-guilty-of-the-murders-of-two-victoria-police-officers-in-1998">was acquitted</a> in a retrial after serving two decades in prison for the murder of two police officers. </p>
<p>Scott Austic in WA was <a href="https://www.abc.net.au/news/2022-04-04/how-evidence-tampering-put-scott-in-jail-for-a-murder/100631388">acquitted</a> in retrial after serving 12 years for the murder of his partner who was pregnant with his child.</p>
<p>David Eastman in the ACT was <a href="https://www.theguardian.com/australia-news/2019/oct/14/david-eastman-awarded-7m-for-19-years-of-wrongful-imprisonment">acquitted</a> in a retrial after serving 20 years for the murder of assistant police commissioner Colin Winchester.</p>
<p>Henry Keogh in SA was <a href="https://www.abc.net.au/news/2019-04-12/henry-keogh-welcomes-court-ruling-supporting-release-of-report/10999392">freed</a> following an exceptional second appeal having served 20 years for the murder of his fiancé.</p>
<p>In these cases, as in the Folbigg case, the subsequent proceedings considered fresh forensic evidence or highlighted flaws in the original proceedings or investigation.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/serial-podcasts-adnan-syed-has-murder-conviction-vacated-how-common-are-wrongful-convictions-190968">'Serial' podcast's Adnan Syed has murder conviction vacated. How common are wrongful convictions?</a>
</strong>
</em>
</p>
<hr>
<h2>Systemic solution</h2>
<p>It’s a primary goal of the criminal justice system to avoid the searing injustice of a wrongful conviction. This goal is pursued through principles such as the presumption of innocence and the requirement of proof beyond reasonable doubt.</p>
<p>But absolute certainty in guilt isn’t feasible and isn’t required. A risk of error is run and occasional errors should be expected. They will not necessarily be corrected on appeal, where the defendant is no longer presumed innocent and weight is given to the “finality principle”. This means the jury verdict is ordinarily considered final, for the sake of efficiency and to provide the parties and society with closure. </p>
<p>Following an unsuccessful appeal, the finality principle bites still harder and it becomes significantly more difficult for the wrongly convicted defendant to achieve justice. The imprisoned defendant will face an almost insurmountable challenge in persuading the government (or, in some jurisdictions, court) to order an inquiry or an exceptional subsequent appeal. In order to achieve justice, defendants like Folbigg, Roberts, Keogh and Eastman require remarkable resilience, as well as supporters on the outside.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/why-is-it-so-hard-for-the-wrongfully-jailed-to-get-justice-84143">Why is it so hard for the wrongfully jailed to get justice?</a>
</strong>
</em>
</p>
<hr>
<p>The criminal justice system needs to do more to address the statistical certainty of the occasional wrongful conviction. Overcoming this injustice shouldn’t demand superhuman reserves of fortitude, or the chance arrival of a champion.</p>
<p>The systemic risk of wrongful conviction demands a systemic solution.</p>
<p>Other developed nations have recognised that CCRCs are well-suited to this task, including England and Wales, Scotland, New Zealand, and Canada. Australia should follow in this path. </p>
<p>The extent of the change can be carefully calibrated through the design of the CCRC. The CCRC is a gatekeeper, and legislation can determine how widely the gate is opened.</p>
<p>The call for this key piece of criminal justice infrastructure isn’t new. The Australian Law Council <a href="https://www.lawcouncil.asn.au/resources/policies-and-guidelines/policy-statement-commonwealth-criminal-cases-review-commission">expressed support for a federal CCRC in 2012</a>. Commentators have called for an Australian CCRC <a href="http://classic.austlii.edu.au/au/journals/UNSWLawJl/2014/12.html">on many occasions</a>.</p>
<p>Last year former High Court Justice, Michael Kirby, <a href="https://www.sydneycriminallawyers.com.au/blog/an-australian-criminal-cases-review-commission-an-interview-with-former-high-court-justice-michael-kirby/?utm_source=mondaq&utm_medium=syndication&utm_term=Criminal-Law&utm_content=articleoriginal&utm_campaign=article">reiterated his view</a> that “such a commission is needed”. And the <a href="https://www.sydney.edu.au/law/our-research/research-centres-and-institutes/sydney-institute-of-criminology.html">Sydney Institute of Criminology</a> is currently calling on governments to take steps to establish an Australian CCRC. </p>
<p>Cases like Folbigg’s demonstrate that this reform is urgently required.</p><img src="https://counter.theconversation.com/content/205645/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>The authors do not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and have disclosed no relevant affiliations beyond their academic appointment.</span></em></p>Such bodies have proven to bring a cost-effective improvement to the accuracy of criminal justice systems overseas.David Hamer, Professor of Evidence Law, University of SydneyAndrew Dyer, Senior Lecturer, The University of Sydney Law School; Director Sydney Institute of Criminology, University of SydneyLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/2047972023-05-03T20:17:39Z2023-05-03T20:17:39ZWho owned this Stone Age jewellery? New forensic tools offer an unprecedented answer<figure><img src="https://images.theconversation.com/files/523993/original/file-20230503-16-syi8cw.jpg?ixlib=rb-1.1.0&rect=5%2C0%2C3982%2C3000&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">
</span> <span class="attribution"><span class="source">Max Planck Institute for Evolutionary Anthropology</span></span></figcaption></figure><p>An international team of researchers has recovered DNA from the owner of a deer-tooth pendant that was buried inside a remote Siberian cave for tens of thousands of years.</p>
<p>In <a href="https://www.nature.com/articles/s41586-023-06035-2">research published in Nature</a>, Elena Essel of the Max Planck Institute for Evolutionary Anthropology in Germany and colleagues detail how they developed a new technique to extract DNA left behind on an artefact.</p>
<p>In much the same way police solve crimes using “touch DNA” – DNA recovered from skin cells or trace bodily fluids left behind when somebody touches an object – archaeologists will now be able to recover genetic traces of ancient humans from the artefacts they left behind.</p>
<p>These traces will reveal the biological sex and genetic ancestry of the individual who once held or wore a particular artefact, allowing archaeologists to link genetic and cultural evidence as they attempt to unravel the deep past.</p>
<h2>Prehistoric artefacts and touch DNA</h2>
<p>When archaeologists find artefacts such as tools and ornaments at a site, it’s not easy to work out who used them. </p>
<p>Until now, we have had to rely on finding artefacts in “direct association” with buried people. That is, we could only link an individual to an ornament if we found them buried wearing it. </p>
<p>Even then, this funerary association isn’t always a guide to what happened in life. The dead are buried with things their community think they should have, which may not have been theirs when they were alive. </p>
<p>This new method of ancient DNA extraction provides a more direct way of determining who used specific items in everyday life.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/523725/original/file-20230502-1369-p0y4tt.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="A photo of a woman in clean-room gear holding a small bone object inside a perspex box." src="https://images.theconversation.com/files/523725/original/file-20230502-1369-p0y4tt.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/523725/original/file-20230502-1369-p0y4tt.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=467&fit=crop&dpr=1 600w, https://images.theconversation.com/files/523725/original/file-20230502-1369-p0y4tt.jpeg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=467&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/523725/original/file-20230502-1369-p0y4tt.jpeg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=467&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/523725/original/file-20230502-1369-p0y4tt.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=587&fit=crop&dpr=1 754w, https://images.theconversation.com/files/523725/original/file-20230502-1369-p0y4tt.jpeg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=587&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/523725/original/file-20230502-1369-p0y4tt.jpeg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=587&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Elena Essel working on the pierced deer tooth discovered at Denisova Cave.</span>
<span class="attribution"><span class="source">Max Planck Institute for Evolutionary Anthropology</span></span>
</figcaption>
</figure>
<p>The method can only be used for artefacts made from bone or tooth as these materials are porous and can soak up human DNA from repeated contact with bodily fluids (sweat, blood, saliva). Luckily, the <a href="https://link.springer.com/referenceworkentry/10.1007/978-1-4419-0465-2_702#:%7E:text=%22Bone%20tool%22%20is%20a%20generic,address%20a%20variety%20of%20questions.">bones and teeth of animals</a> (and <a href="https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0182127">sometimes humans</a>) were widely used throughout the past to create everyday tools, sacred items, and personal adornment. </p>
<p>These osseous artefacts were held in the hand or worn against the body for extended periods, resulting in sweat and other fluids soaking into their surfaces over time. As a result, the artefact records the genetic information of the wearer. </p>
<p>Through experimentation with different techniques, Essel and her team found a way to recover that DNA record in a form that is intact enough to be read.</p>
<h2>Is this yours?</h2>
<p>Using this new method of DNA extraction, the researchers were able to extract a wealth of archaeological information from a single tooth pendant recovered from the famous archaeological site of Denisova Cave in Siberia.</p>
<p>The cave, tucked away in the foothills of the Altai mountains, has fascinated researchers for decades as its past inhabitants included not only <em>Homo sapiens</em> but also Neanderthals and another enigmatic extinct human species known as Denisovans.</p>
<figure class="align-center ">
<img alt="A photo of the entrance to a cave in a tree-covered hill." src="https://images.theconversation.com/files/523756/original/file-20230502-26-glp9vv.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/523756/original/file-20230502-26-glp9vv.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=450&fit=crop&dpr=1 600w, https://images.theconversation.com/files/523756/original/file-20230502-26-glp9vv.jpeg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=450&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/523756/original/file-20230502-26-glp9vv.jpeg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=450&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/523756/original/file-20230502-26-glp9vv.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=566&fit=crop&dpr=1 754w, https://images.theconversation.com/files/523756/original/file-20230502-26-glp9vv.jpeg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=566&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/523756/original/file-20230502-26-glp9vv.jpeg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=566&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Over the millennia, Denisova Cave has been inhabited by Homo sapiens as well as our extinct cousins the Neanderthals and Denisovans.</span>
<span class="attribution"><span class="source">Richard G. Roberts</span></span>
</figcaption>
</figure>
<p>First, they were able to extract the DNA of the animal the tooth belonged to, a wapiti deer (<em>Cervus canadensis</em>).</p>
<p>They were then able to extract human DNA from the pores of the tooth and deduce that this DNA had come from a female individual whose ancestry is most similar to ancient people found further east in Siberia and with Native Americans.</p>
<p>They were also able to use the DNA data to estimate the date of the pendant’s creation, somewhere between 19,000 and 25,000 years ago. This date fits with previous radiocarbon dating of the layer of the cave floor sediment in which the artefact was found.</p>
<figure>
<iframe width="440" height="260" src="https://www.youtube.com/embed/VYec_Ti2H4Q?wmode=transparent&start=0" frameborder="0" allowfullscreen=""></iframe>
<figcaption><span class="caption">DNA found in soil, or “environmental DNA”, can also inform our understanding of who used an archaeological site such as Denisova Cave.</span></figcaption>
</figure>
<p>Without the extraction and analysis of the human DNA held in the tooth, archaeologists would have been able to tell what animal it had come from and how old it was. However, we could never have guessed the owner of this ornament. Now we can identify a specific individual. </p>
<p>Using the additional DNA information attached to individual artefacts, archaeologists will be able to create an understanding of past societies with a level of detail never before possible.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/dirty-secrets-sediment-dna-reveals-a-300-000-year-timeline-of-ancient-and-modern-humans-living-in-siberia-161585">Dirty secrets: sediment DNA reveals a 300,000-year timeline of ancient and modern humans living in Siberia</a>
</strong>
</em>
</p>
<hr>
<img src="https://counter.theconversation.com/content/204797/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Michelle Langley is an Associate Professor of Archaeology in the Australian Research Centre for Human Evolution at Griffith University. She receives funding from the ARC. </span></em></p>A way to recover the owner’s DNA from ancient artefacts will help archaeologists understand past societies in more detail than ever before.Michelle Langley, Associate Professor of Archaeology, Griffith UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1998282023-03-17T13:15:31Z2023-03-17T13:15:31ZThe camera never lies? Our research found CCTV isn’t always dependable when it comes to murder investigations<figure><img src="https://images.theconversation.com/files/514486/original/file-20230309-1177-u0roc3.jpg?ixlib=rb-1.1.0&rect=0%2C0%2C3840%2C2149&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">"The camera never lies," goes the old adage. But how true is that?</span> <span class="attribution"><a class="source" href="https://www.shutterstock.com/image-photo/elevated-security-camera-surveillance-footage-crowd-2198446515">Gorodenkoff/Shutterstock</a></span></figcaption></figure><p>As a victim or suspect of a crime, or witness to an offence, you may find your actions, behaviour and character scrutinised by the police or a barrister using CCTV footage. You may assume all the relevant footage has been gathered and viewed. You may sit on a jury and be expected to evaluate CCTV footage to help determine whether you find a defendant guilty or innocent. </p>
<p>You may believe you will see all the key images. You may trust the camera never lies. </p>
<p>However, the evidence we gathered during our <a href="https://www.tandfonline.com/doi/epdf/10.1080/10439463.2021.1879075?needAccess=true&role=button">study</a> of British murder investigations and trials reveals how, like other forms of evidence such as DNA and fingerprints, CCTV footage requires careful interpretation and evaluation and can be misleading. </p>
<p>Instead of providing an absolute “truth”, different meanings can be obtained from the same footage. But understanding the challenges and risks associated with CCTV footage is vital in a fair and transparent system to prevent possible <a href="https://www.lexisnexis.co.uk/legal/glossary/miscarriage-of-justice">miscarriages of justice</a>.</p>
<h2>Evidence</h2>
<p>The justice system often relies upon digital <a href="https://www.npcc.police.uk/SysSiteAssets/media/downloads/publications/publications-log/2020/national-digital-forensic-science-strategy.pdf">evidence</a> to support investigations and prosecutions and CCTV is one of the most relied upon forms. Recent <a href="https://clarionuk.com/resources/how-many-cctv-cameras-are-in-london/">estimates</a> suggest there are more than 7.3 million cameras in the UK, which can capture a person up to 70 times per day. </p>
<p>The public may be filmed on council-owned CCTV, by cameras in commercial premises, or at residential premises (home cameras or <a href="https://www.which.co.uk/reviews/smart-video-doorbells/article/genuinely-useful-things-you-can-do-with-a-smart-doorbell-a0JXE2q1niZk">smart doorbells</a>, as well as on public transport and by dash cams.</p>
<figure class="align-center ">
<img alt="A man sits at a desk in front of a bank of screens, each showing footage from CCTV cameras." src="https://images.theconversation.com/files/514644/original/file-20230310-18-zjd7oi.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/514644/original/file-20230310-18-zjd7oi.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=338&fit=crop&dpr=1 600w, https://images.theconversation.com/files/514644/original/file-20230310-18-zjd7oi.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=338&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/514644/original/file-20230310-18-zjd7oi.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=338&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/514644/original/file-20230310-18-zjd7oi.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=424&fit=crop&dpr=1 754w, https://images.theconversation.com/files/514644/original/file-20230310-18-zjd7oi.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=424&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/514644/original/file-20230310-18-zjd7oi.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=424&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">CCTV is one of the most popular forms of digital forensic evidence.</span>
<span class="attribution"><a class="source" href="https://www.shutterstock.com/image-photo/industry-40-modern-factory-security-operator-1936528570">Gorodenkoff/Shutterstock</a></span>
</figcaption>
</figure>
<p>In our study of 44 British murder investigations, we showed how CCTV provides many benefits to investigators. It can help identify suspects and witnesses, and implicate or eliminate suspects. It can also help to corroborate or refute accounts provided by suspects and witnesses. However, our findings also indicate how CCTV can be unreliable and problematic.</p>
<h2>Shortcomings</h2>
<p>CCTV is sometimes inaccessible or lost because the detective who is sent to retrieve the footage lacks the skills, training or equipment to recover it in a timely manner. This is especially important since CCTV is often <a href="https://link.springer.com/article/10.1007/s13347-016-0218-2">deleted</a> within three weeks of being recorded. We found that it was often over-written within 7 to 10 days. </p>
<p>At other times, owners are unable to access systems or cannot manage the volume of CCTV requested, for instance, when taking buses out of service for footage to be downloaded. And even when footage is successfully seized, there may not be officers available to view it all. </p>
<p>There is also the risk that important footage which could exonerate a suspect is not <a href="https://www.cps.gov.uk/about-cps/disclosure#:%7E:text=Disclosure%20is%20providing%20the%20defence,is%20done%20properly%2C%20and%20promptly">disclosed</a> to the defence, which could mean innocent people are <a href="https://www.sciencedirect.com/science/article/abs/pii/S1752928X18301859?via%3Dihub">imprisoned</a>.</p>
<figure>
<iframe width="440" height="260" src="https://www.youtube.com/embed/lQRfM4Nt6dI?wmode=transparent&start=0" frameborder="0" allowfullscreen=""></iframe>
<figcaption><span class="caption">A 2022 Channel 4 News investigation looked at whether CCTV is helping to put innocent people behind bars.</span></figcaption>
</figure>
<p>Detectives must frequently make sense of poor-quality images that are blurry or grainy. This is not easy. In some of the investigations we observed, the police tried to enhance poor-quality images, though this was not always successful. </p>
<p>Investigators must also decide whether to draw on <a href="https://www.cps.gov.uk/legal-guidance/expert-evidence">experts</a> to interpret footage and present evidence at court. However, the police have no clear guidance to help determine whether and when to draw on such expertise. We observed cases where officers decided against expert input because they were confident of their own interpretations.</p>
<p>Our study also revealed how some detectives or CCTV officers are used repeatedly to view or interpret footage because they are regarded by others (or assign themselves) as <a href="https://theconversation.com/facial-recognition-research-reveals-new-abilities-of-super-recognisers-128414">“super-recognisers”</a>. These are people who may be better at recognising faces than others. However, there is no <a href="https://theconversation.com/from-super-recognisers-to-the-face-blind-how-tests-reveal-the-underlying-cognitive-processes-176589">robust measure</a> for determining whether someone is a super-recogniser. Furthermore, if super-recognisers are incorrectly viewed as expert witnesses, their evidence could be overvalued during a police investigation or at court.</p>
<p>By the time CCTV footage is shown to a jury, it has been choreographed carefully by the police and prosecution barrister. They are often adept at selecting, organising and editing footage into slick packages. </p>
<p>These techniques are also used by the defence who deliberate over whether to use moving footage or still images, at what speed to show the clips and at what point to add commentary. This is to demonstrate an <a href="https://ejournals.bc.edu/index.php/elements/article/view/9453">“alternative truth”</a> and provide a contested interpretation of the same footage. It might be difficult for juries to determine how the footage has been edited.</p>
<h2>Gold standard?</h2>
<p>Murder investigations are generally regarded to be the <a href="https://www.tandfonline.com/doi/full/10.1080/10439463.2013.771538">gold standard</a> of criminal investigation, due to the investment of time, resources and expertise. Nevertheless, we uncovered many challenges, errors and risks involved in the use of CCTV. These are likely to be even greater in other kinds of criminal investigation, where staffing and knowledge of <a href="https://www.sciencedirect.com/science/article/pii/S1355030621001295">digital evidence</a> may be more limited.</p>
<p>The complexities of CCTV evidence need to be understood by everyone involved in handling, interpreting and presenting footage, as well as by those of us whose actions and accounts may be scrutinised on the basis of CCTV footage. </p>
<p>The challenges and risks identified here are likely to intensify as digital technologies advance - demonstrated by recent concerns with <a href="https://www.bsia.co.uk/zappfiles/bsia-front/public-guides/form_347_automated_facial%20recognition_a_guide_to_ethical_and_legal_use-compressed.pdf">automated facial recognition technologies</a> and the risk of <a href="https://theconversation.com/3-2-billion-images-and-720-000-hours-of-video-are-shared-online-daily-can-you-sort-real-from-fake-148630">deepfake videos</a>.</p><img src="https://counter.theconversation.com/content/199828/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>This research was funded by The Leverhulme Trust. </span></em></p><p class="fine-print"><em><span>This research was funded by The Leverhulme Trust.</span></em></p>CCTV is a popular form of digital evidence but it can be unreliable and problematic.Helen Jones, Research Fellow, University of South WalesFiona Brookman, Professor of Criminology, University of South WalesLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/2007412023-03-06T19:03:27Z2023-03-06T19:03:27ZLie detection tests have worked the same way for 3,000 years – and they’re still hopelessly inaccurate<figure><img src="https://images.theconversation.com/files/513528/original/file-20230306-22-kq0lr2.jpg?ixlib=rb-1.1.0&rect=50%2C0%2C5615%2C3741&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">
</span> <span class="attribution"><span class="source">Shutterstock</span></span></figcaption></figure><p>Popular culture is fascinated with the ability to detect liars. Lie detector tests are a staple of police dramas, and TV shows such as Poker Face feature “human polygraphs” who detect deception by picking up tell-tale signs in people’s behaviour. </p>
<p>Records of attempts to detect lies, whether by technical means or by skilled observers, go back at least 3,000 years. Forensic science lie detection techniques have become <a href="https://onlinelibrary.wiley.com/doi/10.1111/j.1541-1338.2005.00166.x">increasingly popular</a> since the invention of the polygraph early in the 20th century, with the latest methods involving advanced brain imaging. </p>
<p>Proponents of lie detection technology sometimes <a href="https://www.press.umich.edu/3091709/lying_brain">make grandiose claims</a>, such as a <a href="https://doi.org/10.1007/s11896-022-09566-y">recent paper</a> that said “with the help of forensic science and its new techniques, crimes can be easily solved”.</p>
<p>Despite these claims, an infallible lie detection method has yet to be found. In fact, most lie detection methods don’t detect lies at all – instead, they register the physiological or behaviour signs of stress or fear. </p>
<h2>From dry rice to red-hot irons</h2>
<p>The <a href="https://journals.sagepub.com/doi/10.1177/1529100610390861">earliest recorded lie detection method</a> was used in China, around 1000 BC. It involved suspects placing rice in their mouths then spitting it out: wet rice indicated innocence, while dry rice meant guilty. </p>
<figure class="align-center ">
<img alt="" src="https://images.theconversation.com/files/513532/original/file-20230306-1839-hr80u4.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/513532/original/file-20230306-1839-hr80u4.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=450&fit=crop&dpr=1 600w, https://images.theconversation.com/files/513532/original/file-20230306-1839-hr80u4.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=450&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/513532/original/file-20230306-1839-hr80u4.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=450&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/513532/original/file-20230306-1839-hr80u4.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=566&fit=crop&dpr=1 754w, https://images.theconversation.com/files/513532/original/file-20230306-1839-hr80u4.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=566&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/513532/original/file-20230306-1839-hr80u4.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=566&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">In ancient China, chewing dry rice was used a way to determine whether a person was speaking the truth or telling lies.</span>
<span class="attribution"><span class="source">Shutterstock</span></span>
</figcaption>
</figure>
<p>In India, around 900 BC, <a href="http://scholarlycommons.law.northwestern.edu/cgi/viewcontent.cgi?article=2844&context=jclc">one method</a> used to detect poisoners was observations of shaking. In ancient Greece a rapid pulse rate was taken to indicate deceit. </p>
<p>The Middle Ages saw barbaric forms of lie detection used in Europe, such as the red-hot iron method which involved suspected criminals placing their tongue, often multiple times, on a red-hot iron. Here, a burnt tongue indicated guilt. </p>
<h2>What the polygraph measures</h2>
<p>Historical lie detection methods were based in superstition or religion. However, in the early 20th century a purportedly scientific, objective, lie detection machine was invented: the polygraph.</p>
<p>The <a href="https://www.ojp.gov/pdffiles1/nij/grants/228091.pdf">polygraph measures</a> a person’s respiration, heart rate, blood pressure, and skin conductance (sweating) during questioning. </p>
<p>Usually a “control question” about a crime is asked, such as “Did you do it?” The person’s response to the control question is then compared to responses to neutral or less provocative questions. Heightened reactions to direct crime questions are taken to indicate guilt on the test. </p>
<h2>The overconfidence of law enforcers</h2>
<p>Some law enforcement experts claim they don’t even need a polygraph. They can detect lies simply by observing the behaviour of a suspect during questioning.</p>
<p>Worldwide research shows that law enforcers are often <a href="https://doi.org/10.5093/apj2022a4">confident they can detect lying</a>. Many assume a suspect’s nonverbal behaviour reveals deceit. </p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/513539/original/file-20230306-3839-d63rop.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/513539/original/file-20230306-3839-d63rop.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/513539/original/file-20230306-3839-d63rop.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/513539/original/file-20230306-3839-d63rop.jpeg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/513539/original/file-20230306-3839-d63rop.jpeg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/513539/original/file-20230306-3839-d63rop.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/513539/original/file-20230306-3839-d63rop.jpeg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/513539/original/file-20230306-3839-d63rop.jpeg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Unlike Poker Face’s ‘human polygraph’, the lie-detection efforts of real-life law enforcers are often fallible.</span>
<span class="attribution"><span class="source">Peacock</span></span>
</figcaption>
</figure>
<p>A <a href="https://www.emerald.com/insight/content/doi/10.1108/14636641111134314/full/html">2011 study with Queensland police</a> revealed many officers were confident they could detect lying. Most favoured a focus on nonverbal behaviour even over available evidence. </p>
<p>However, <a href="https://link.springer.com/chapter/10.1007/978-3-319-96334-1_3">research shows</a> that law enforcers, despite their confidence, are often not very good at detecting lying. </p>
<p>Law enforcement officers are not alone in thinking they can spot a liar. <a href="https://journals.sagepub.com/doi/10.1177/0022022105282295">Global studies</a> have found that people around the world believe lying is accompanied by specific nonverbal behaviours such as gaze aversion and nervousness.</p>
<h2>What’s really being tested</h2>
<p>Many historical and current lie detection methods seem underpinned by the plausible idea that liars will be nervous and display observable physical reactions. </p>
<p>These might be shaking (such as in the ancient Indian test for poisoners, and the nonverbal behaviour method used by some investigators), a dry mouth (the rice-chewing test and the hot-iron method), increased pulse rate (the ancient Greek method and the modern polygraph), or overall heightened physiological reactions (the polygraph). </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/hows-your-poker-face-why-its-so-hard-to-sniff-out-a-liar-25487">How's your poker face? Why it's so hard to sniff out a liar</a>
</strong>
</em>
</p>
<hr>
<p>However, there are two major problems with using behaviour based on fear or stress to detect lying. </p>
<p>The first problem: how does one distinguish fearful innocents from fearful guilty people? It is likely that an innocent person accused of a crime will be fearful or anxious, while a guilty suspect may not be. </p>
<p>This is borne out with the polygraph’s <a href="https://nap.nationalacademies.org/read/10420/chapter/10#218">high false-positive rate</a>, meaning innocent people are deemed guilty. Similarly, some police have assumed that <a href="https://cqu-primo.hosted.exlibrisgroup.com/permalink/f/1rb43gr/TN_cdi_informaworld_taylorfrancisbooks_9781843926337">innocent, nervous suspects were guilty</a> based on inaccurate interpretations of behavioural observations.</p>
<p>The second major problem with lie detection methods based on nervous behaviour is there is <a href="https://journals.copmadrid.org/apj/art/apj2019a9">no evidence</a> that specific nonverbal behaviours reliably accompany deception.</p>
<h2>Miscarriages of justice</h2>
<p>Despite what we know about the inaccuracy of polygraph tests, they haven’t gone away. </p>
<p>In the US, they are still used in some police interrogations and <a href="https://www.wired.com/story/inside-polygraph-job-screening-black-mirror/">high-security job interviews</a>. In the UK, lie detector tests are used for <a href="https://www.gov.uk/government/publications/domestic-abuse-bill-2020-factsheets/mandatory-polygraph-tests-factsheet">some sex offenders on probation</a>. And in China, the use of polygraphs in law enforcement may <a href="https://www.sciencedirect.com/science/article/abs/pii/S0031938414005964?via%3Dihub">even be increasing</a>.</p>
<p>Australia has been less enthusiastic in adopting lie-detection machines. In New South Wales, the use of lie-detector findings was barred from court in 1983, and an attempt to present polygraph evidence to a court in Western Australia in 2003 <a href="https://www.tandfonline.com/doi/abs/10.1375/pplt.2004.11.2.359">also failed</a>.</p>
<p>Many historical and current lie detection methods emulate each other and are based on the same assumptions. Often the <a href="https://muse.jhu.edu/book/13865">only difference</a> is the which part of the body or physical reacion they focus on.</p>
<p>Using fallible lie detection methods <a href="https://journals.copmadrid.org/apj/art/apj2022a4">contributes to wrongful convictions</a> and miscarriages of justice. </p>
<p>Therefore, it is important that criminal-justice practitioners are educated about fallacious lie detection methods, and any new technique grounded in fear or stress-based reactions should be rejected. </p>
<p>Despite outward appearances of technological advancement, over many millennia little has changed. Fearful innocents remain vulnerable to wrongful assumptions of guilt, which is good news for the fearless guilty.</p><img src="https://counter.theconversation.com/content/200741/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>The authors do not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and have disclosed no relevant affiliations beyond their academic appointment.</span></em></p>Most methods for detecting lies actually detect signs of stress – which makes them extremely unreliable.Rebecca Wilcoxson, Lecturer in Forensic Psychology, CQUniversity AustraliaEmma Turley, Senior Lecturer in Criminology, CQUniversity AustraliaLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1980962023-01-31T17:15:09Z2023-01-31T17:15:09ZSix parts of your car that gather data on you<figure><img src="https://images.theconversation.com/files/505918/original/file-20230123-7791-gznfp8.jpg?ixlib=rb-1.1.0&rect=60%2C0%2C6720%2C4466&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">
</span> <span class="attribution"><span class="source">New Africa/Shutterstock</span></span></figcaption></figure><p>You can tell a lot about someone from the car they drive. The data that many vehicles now collect can reveal the patterns of our daily lives and provide insights into our behaviour, actions and even our state of mind.</p>
<p><a href="https://sytech-consultants.com/the-evolution-of-vehicle-forensics/">Vehicle forensics</a> is a type of digital forensic science that focuses on the identification, acquisition and analysis of data which has been stored by cars, vans and lorries. </p>
<p>Originally, vehicle forensics mainly related to the external identification of stolen cars or tax and MOT violations by the use of the <a href="https://www.police.uk/advice/advice-and-information/rs/road-safety/automatic-number-plate-recognition-anpr/">ANPR (automatic number plate recognition) system</a> in the UK. The system was invented during the 1970s but did not become widely used by the police <a href="http://www.anpr-international.com/history-of-anpr/">until the late 1990s</a>. ANPR works by scanning number plates and checking them against a database of vehicles of interest. </p>
<p>However, in recent years, the process of prosecuting offenders has become <a href="https://www.police-foundation.org.uk/project/the-next-steps-for-digital-forensics/">more sophisticated</a> and now also encompasses the extraction of <a href="https://berla.co/discover/">data from inside vehicles</a>. From the mechanisms used to enhance the driving experience to inbuilt entertainment systems, all can assist in the detection of crime and can be <a href="https://www.inbrief.co.uk/court-proceedings/computer-evidence/">admissible as evidence in court</a>. </p>
<h2>1. The black box</h2>
<p>Black boxes are devices used within vehicles to monitor an individual’s driving skills. They are not present in every vehicle but they are <a href="https://www.confused.com/car-insurance/black-box/telematics-explained">popular with insurance companies</a>. If the data from the black box reveals a driver is performing well behind the wheel, it can be used to lower their premium. </p>
<p>Alongside recording GPS coordinates, black boxes can show how far a vehicle has travelled, how often it has been driven, as well as braking and cornering ability, for example. </p>
<h2>2. The infotainment system</h2>
<p>Listening to music while driving used to involve a simple cassette or CD player. But slowly these systems gave way to Bluetooth, wifi and USB devices, which can be operated by using touch screens or displays installed on dashboards. </p>
<p>As well as providing information and entertainment, the <a href="https://www.cazoo.co.uk/the-view/buying/what-is-a-car-infotainment-system/">infotainment system</a> is often how drivers interact with other functions of the vehicle, such as displaying how much fuel has been used and controlling how warm the seats are.</p>
<figure class="align-center ">
<img alt="Finger pressing car infotainment system screen" src="https://images.theconversation.com/files/506061/original/file-20230124-17-pev4g9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/506061/original/file-20230124-17-pev4g9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/506061/original/file-20230124-17-pev4g9.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/506061/original/file-20230124-17-pev4g9.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/506061/original/file-20230124-17-pev4g9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/506061/original/file-20230124-17-pev4g9.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/506061/original/file-20230124-17-pev4g9.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Infotainment system.</span>
<span class="attribution"><span class="source">Vladimka production/Shutterstock</span></span>
</figcaption>
</figure>
<p>When smartphones are plugged into cars or paired via Bluetooth, the infotainment system can store data such as navigation history, text messages and emails, internet browsing history and social media feeds, as well as Bluetooth and cell tower connections.</p>
<h2>3. Electronic control units</h2>
<p>Electronic control units or ECUs assist with how a vehicle works and are often described as the <a href="https://blog.halfords.com/a-complete-guide-to-engine-control-units/">“brain” of the engine</a>. They are situated within the car’s interior, usually in the glove compartment, engine space or under the dashboard. Essentially, an ECU is a computer, a switching system and a power management system housed within a very small case. </p>
<p>There are usually more than 75 ECUs in a vehicle and each one is responsible for a certain task. For example, the engine ECU controls the injection of the fuel and, in petrol engines, the timing of the spark to ignite it. Fastened seat belts, air pressure, and lights turning on and off are also all functions of ECUs.</p>
<figure class="align-center ">
<img alt="Close up of a car's engine compartment" src="https://images.theconversation.com/files/506115/original/file-20230124-1539-lprcyx.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/506115/original/file-20230124-1539-lprcyx.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=551&fit=crop&dpr=1 600w, https://images.theconversation.com/files/506115/original/file-20230124-1539-lprcyx.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=551&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/506115/original/file-20230124-1539-lprcyx.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=551&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/506115/original/file-20230124-1539-lprcyx.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=692&fit=crop&dpr=1 754w, https://images.theconversation.com/files/506115/original/file-20230124-1539-lprcyx.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=692&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/506115/original/file-20230124-1539-lprcyx.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=692&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">The electronic control unit of the car installed in the engine compartment.</span>
<span class="attribution"><span class="source">Henadzi Kilent/Shutterstock</span></span>
</figcaption>
</figure>
<p>To assist with driver efficiency, the ECUs and the infotainment system often work together, storing a wide variety of data about the ways in which a vehicle is used.</p>
<h2>4. eCall units</h2>
<p><a href="https://www.autoexpress.co.uk/car-tech/101706/what-is-ecall-automated-emergency-call-technology-explained">Emergency call, or eCall</a>, units were introduced to new vehicles across the EU and UK in 2018. This is an emergency system that aims to bring rapid assistance if and when there are road traffic incidents. Vehicle sensors can identify collisions and can detect if the airbags have been deployed. This in turn activates a call to the emergency services. </p>
<figure class="align-center ">
<img alt="Finger pressing SOS button" src="https://images.theconversation.com/files/506118/original/file-20230124-21-mpu9qm.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/506118/original/file-20230124-21-mpu9qm.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=397&fit=crop&dpr=1 600w, https://images.theconversation.com/files/506118/original/file-20230124-21-mpu9qm.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=397&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/506118/original/file-20230124-21-mpu9qm.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=397&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/506118/original/file-20230124-21-mpu9qm.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=499&fit=crop&dpr=1 754w, https://images.theconversation.com/files/506118/original/file-20230124-21-mpu9qm.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=499&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/506118/original/file-20230124-21-mpu9qm.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=499&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">A car’s manual eCall button.</span>
<span class="attribution"><span class="source">Lanski/Shutterstock</span></span>
</figcaption>
</figure>
<p>The data collected by eCall includes the vehicle’s GPS coordinates, the direction of travel, the <a href="https://www.gov.uk/vehicle-registration/vehicle-identification-number">VIN (vehicle identification number)</a>, the type of fuel used and even whether seat belts were fastened or not. </p>
<h2>5. Key fobs</h2>
<p>Beyond their most obvious function in locking and unlocking our cars, <a href="https://www.linkedin.com/pulse/car-keys-its-types-forensic-significance-iasrorg?trk=public_post-content_share-article">key fobs contain a remarkable amount of information</a>. Some of the data stored within a fob includes the VIN, the number of keys paired to a particular vehicle and the last time the vehicle was locked and unlocked.</p>
<h2>6. Cameras</h2>
<p><a href="https://www.which.co.uk/reviews/dash-cams/article/dash-cams-and-the-law-what-you-need-to-know-aUty85w5AYQC">Reverse and dashboard cameras</a> can assist with parking and provide accident footage for insurance investigators. But they can also reveal the journey travelled by the vehicle alongside date and time stamps, as well as road positioning. </p>
<p>Additionally, dash cameras can capture images of other road users and pedestrians. The <a href="https://nextbase.co.uk/national-dash-cam-safety-portal/">national dash cam safety portal</a> allows camera owners to submit footage to police forces in England and Wales, which can then be used by investigators.</p><img src="https://counter.theconversation.com/content/198096/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Rachael Medhurst does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>Our vehicles hold a remarkable amount of information, which can be used by digital forensic investigators in the detection of crime.Rachael Medhurst, Course Leader and Lecturer in Cyber Security NCSA, University of South WalesLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1919372022-10-11T19:04:19Z2022-10-11T19:04:19ZDNA is often used in solving crimes. But how does DNA profiling actually work?<figure><img src="https://images.theconversation.com/files/488905/original/file-20221010-58507-19oz7r.jpg?ixlib=rb-1.1.0&rect=229%2C97%2C3604%2C2057&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">
</span> <span class="attribution"><span class="source">thinkhubstudio/Shutterstock</span></span></figcaption></figure><p>DNA profiling is frequently in the news. Public interest is sparked when DNA is used to <a href="https://www.abc.net.au/news/2010-07-29/dna-retesting-confirms-murderers-guilt/925028">identify a suspect</a> or <a href="https://www.smh.com.au/national/nsw/missing-sydney-fraudster-melissa-caddick-found-dead-on-nsw-south-coast-20210226-p5760e.html">human remains</a>, or <a href="https://www.npr.org/2022/09/08/1121542171/genealogy-dna-murder-stacey-lyn-chahorski-henry-frederick-wise-michigan-georgia">resolves a cold case</a> that seems all but forgotten.</p>
<p>Very occasionally, it is in the media when <a href="https://www.theguardian.com/australia-news/2022/oct/04/queensland-lab-could-have-tested-more-samples-from-scenes-for-less-than-1m-inquiry-hears">the process doesn’t work as it should</a>.</p>
<p>So what is DNA profiling and how does it work – and why does it sometimes not work?</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/australia-has-2-000-missing-persons-and-500-unidentified-human-remains-a-dedicated-lab-could-find-matches-90620">Australia has 2,000 missing persons and 500 unidentified human remains – a dedicated lab could find matches</a>
</strong>
</em>
</p>
<hr>
<h2>A short history of DNA profiling</h2>
<p>DNA profiling, as it has been known since 1994, has been used in the criminal justice system since the late 1980s, and was originally termed “DNA fingerprinting”.</p>
<p>The DNA in every human is very similar – up to <a href="https://www.genome.gov/about-genomics/fact-sheets/Genetics-vs-Genomics#:%7E:text=All%20human%20beings%20are%2099.9,about%20the%20causes%20of%20diseases.">99.9% identical</a>, in fact. But strangely, <a href="https://www.ucsf.edu/news/2017/02/405686/mysterious-98-scientists-look-shine-light-our-dark-genome">about 98% of the DNA in our cells</a> is not gene-related (i.e. has no known function).</p>
<p>This non-coding DNA is largely comprised of sequences of the four bases that make up the DNA in every cell.</p>
<figure class="align-center ">
<img alt="A simple chart showing the very basics of the structure of DNA" src="https://images.theconversation.com/files/489990/original/file-20221017-17-6vxi65.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/489990/original/file-20221017-17-6vxi65.png?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=600&fit=crop&dpr=1 600w, https://images.theconversation.com/files/489990/original/file-20221017-17-6vxi65.png?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=600&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/489990/original/file-20221017-17-6vxi65.png?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=600&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/489990/original/file-20221017-17-6vxi65.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=754&fit=crop&dpr=1 754w, https://images.theconversation.com/files/489990/original/file-20221017-17-6vxi65.png?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=754&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/489990/original/file-20221017-17-6vxi65.png?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=754&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">The four DNA bases are guanine, cytosine, thymine and adenine, forming G-C and T-A pairs.</span>
<span class="attribution"><span class="source">Shutterstock</span></span>
</figcaption>
</figure>
<p>But for reasons unknown, some sections of the sequence are repeated: an example is TCTATCTATCTATCTATCTA where the sequence TCTA is repeated five times. While the number of times this DNA sequence is repeated is constant within a person, it can vary between people. One person might have 5 repeats but another 6, or 7 or 8.</p>
<p>There are a large number of variants and all humans fall into one of them. The detection of these repeats is the bedrock of modern DNA profiling. A DNA profile is a list of numbers, based on the repeated sequences we all have.</p>
<p>The use of these short repeat sequences (the technical term is “<a href="https://nij.ojp.gov/topics/articles/what-str-analysis">short tandem repeat</a>” or STR) started in 1994 when the UK Forensic Science Service <a href="https://doi.org/10.1007/BF01224776">identified four of these regions</a>. The chance that two people taken at random in the population would share the same repeat numbers at these four regions was about 1 in 50,000.</p>
<p>Now, the number of known repeat sequences has expanded greatly, with the latest test looking at 24 STR regions. Using all of the known STR regions results in an infinitesimally small probability that any two random people have the same DNA profile. And herein lies the power of DNA profiling.</p>
<figure class="align-center ">
<img alt="A knife on the ground with the number five on a yellow card in the background" src="https://images.theconversation.com/files/488906/original/file-20221010-44863-e4tu0m.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/488906/original/file-20221010-44863-e4tu0m.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/488906/original/file-20221010-44863-e4tu0m.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/488906/original/file-20221010-44863-e4tu0m.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/488906/original/file-20221010-44863-e4tu0m.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/488906/original/file-20221010-44863-e4tu0m.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/488906/original/file-20221010-44863-e4tu0m.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Swabbing an item left at a crime scene can easily yield enough cells to generate a DNA profile.</span>
<span class="attribution"><span class="source">Fuss Sergey/Shutterstock</span></span>
</figcaption>
</figure>
<h2>How is DNA profiling performed?</h2>
<p>The repeat sequence will be the same in every cell within a person – thus, the DNA profile from a blood sample will be the same as from a plucked hair, inside a tooth, saliva, or skin. It also means a DNA profile will not in itself indicate from what type of tissue it originated.</p>
<p>Consider a knife alleged to be integral to an investigation. A question might be “who held the knife”? A swab (cotton or nylon) will be moistened and rubbed over the handle to collect any cells present.</p>
<p>The swab will then be placed in a tube containing a cocktail of chemicals that purifies the DNA from the rest of the cellular material – this is a highly automated process. The amount of DNA will then be quantified.</p>
<p>If there is sufficient DNA present, we can proceed to generate a DNA profile. The optimum amount of DNA needed to generate the profile is 500 picograms – this is really tiny and represents only 80 cells!</p>
<figure class="align-center ">
<img alt="A colourful chart on a screen with DNA base code underneath" src="https://images.theconversation.com/files/488901/original/file-20221010-58317-35ipe0.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/488901/original/file-20221010-58317-35ipe0.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=401&fit=crop&dpr=1 600w, https://images.theconversation.com/files/488901/original/file-20221010-58317-35ipe0.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=401&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/488901/original/file-20221010-58317-35ipe0.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=401&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/488901/original/file-20221010-58317-35ipe0.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=504&fit=crop&dpr=1 754w, https://images.theconversation.com/files/488901/original/file-20221010-58317-35ipe0.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=504&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/488901/original/file-20221010-58317-35ipe0.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=504&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">DNA profiling relies on finding repeated sequences in a sample.</span>
<span class="attribution"><span class="source">fotohunter/Shutterstock</span></span>
</figcaption>
</figure>
<h2>How foolproof is DNA profiling?</h2>
<p>DNA profiling is highly sensitive, given it can work from only 80 cells. This is microscopic: the tiniest pinprick of blood holds thousands of blood cells.</p>
<p>Consider said knife – if it had been handled by two people, perhaps including a legitimate owner and a person of interest, yet only 80 cells are present, those 80 cells would not be from only one person but two. Hence there is now a less-than-optimal amount of DNA from either of the people, and the DNA profiling will be a mixture of the two.</p>
<p>Fortunately, <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8535381/">there are several</a> types <a href="https://strmix.com/">of software</a> to pull apart these mixed DNA profiles. However, the DNA profile might be incomplete (the term for this is “partial”); with less DNA data, there will be a reduced power to identify the person.</p>
<p>Worse still, there may be insufficient DNA to generate any meaningful DNA profile at all. If the sensitivity of the testing is pushed further, we might obtain a DNA profile from even a few cells. But this could implicate a person who may have held the knife innocently weeks prior to an alleged event; or be from someone who shook hands with another person who then held the knife.</p>
<p>This later event is called “indirect transfer” and is something to consider with such small amounts of DNA.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/criminals-cant-easily-edit-their-dna-out-of-forensic-databases-96416">Criminals can't easily edit their DNA out of forensic databases</a>
</strong>
</em>
</p>
<hr>
<h2>What can’t DNA profiling do?</h2>
<p>In forensics, using DNA means comparing a profile from a sample to a reference profile, such as taken from a witness, persons of interest, or criminal DNA databases.</p>
<p>By itself, a DNA profile is a set of numbers. The only thing we can figure out is whether the owner of the DNA has a Y-chromosome – that is, their biological sex is male.</p>
<p>A standard STR DNA profile does not indicate anything about the person’s appearance, predisposition to any diseases, and very little about their ancestry.</p>
<p>Other types of DNA testing, such as ones used in genealogy, can be used to associate the DNA at a crime scene to potential genetic relatives of the person – but current standard STR DNA profiling will not link to anyone other that perhaps very close relatives – parents, offspring, or siblings.</p>
<p>DNA profiling has been, and will continue to be, an incredibly powerful forensic test to answer “whose biological material is this”? This is its tremendous strength. As to how and when that material got there, that’s for different methods to sort out.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/new-technology-lets-police-link-dna-to-appearance-and-ancestry-and-its-coming-to-australia-173334">New technology lets police link DNA to appearance and ancestry – and it's coming to Australia</a>
</strong>
</em>
</p>
<hr>
<img src="https://counter.theconversation.com/content/191937/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Adrian Linacre receives funding from the Attorney General's Department of South Australia</span></em></p>Modern DNA sampling is shockingly sensitive – you can get someone’s profile from just 80 cells.Adrian Linacre, Professor of Forensic Genetics, Flinders UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1860102022-09-26T12:30:08Z2022-09-26T12:30:08ZChildren’s eyewitness testimony can be as accurate as adults’ or more so – if interviewers follow these guidelines<figure><img src="https://images.theconversation.com/files/485996/original/file-20220921-15817-m88a16.jpg?ixlib=rb-1.1.0&rect=0%2C75%2C8213%2C5825&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">Researchers know better ways to get accurate information from child witnesses.</span> <span class="attribution"><a class="source" href="https://www.gettyimages.com/detail/photo/at-home-learning-royalty-free-image/1349504236">FatCamera/E+ via Getty Images</a></span></figcaption></figure><p>Eyewitness memory has come under a lot of scrutiny in recent years, as organizations such as the Innocence Project suggest it was a key piece of information in <a href="https://doi.org/10.1525/nclr.2011.14.3.333">as many as 75%</a> of wrongful convictions in the United States. Unfortunately, human memory doesn’t work like a video camera recording a scene, allowing you to play memories back exactly as they happened. Instead, memories must be reconstructed every time they are used, like putting together a jigsaw puzzle. All kinds of things can <a href="https://doi.org/10.3758/BF03195837">influence this reconstruction process</a>, ranging from new information you learn after the event to simply the passage of time.</p>
<p>Adults are bad enough at providing accurate testimony, because of issues related to the reconstructive nature of memory as well as the ways memories can be influenced by new information and decay over time. Considering these limitations of human memory, how well do kids do? The reliability of child witnesses is especially important to understand given the <a href="https://calio.dspacedirect.org/handle/11212/384">large number of children</a> who become involved in the legal system every year. In cases involving child witnesses, the child’s testimony is often <a href="https://doi.org/10.1348/026151005X57657">the only available evidence</a>, so gaining reliable accounts may be the only way to keep dangerous offenders off the streets.</p>
<p><a href="https://scholar.google.com/citations?user=-lZihQgAAAAJ&hl=en">I’m a psychology lecturer</a> at Clemson University <a href="https://sites.google.com/view/ben-f-cotterill/research?authuser=0">who researches children’s eyewitness memory</a>. In my new book “<a href="https://doi.org/10.1007/978-3-031-10382-7">Are Children Reliable Witnesses?</a>” I explore what can influence the accuracy of children’s testimonies, for better or worse. Research shows that children can be reliable witnesses, but it depends on both the individual child and the situation.</p>
<h2>Getting child witnesses to tell their stories</h2>
<p>Typically, police begin a forensic interview by asking witnesses, including children, <a href="https://doi.org/10.1002/acp.1489">to freely recall</a> everything they remember about the event. During this stage of the interview, even young children can be just as accurate as adults, but they <a href="https://doi.org/10.1002/9780470773291">often miss many details</a>.</p>
<p>To elicit the most information possible, police will often then start asking different types of questions. Open-ended questions – for example, “Tell me more about what happened” – generate more accurate and coherent responses <a href="https://doi.org/10.1146/annurev-lawsocsci-110413-030913">than any other type</a>.</p>
<p>Questions that include an option – like “Was he tall?” – can increase the amount of information a witness provides but often lead children to answer questions they actually don’t know the answer to. The overall accuracy of their recollections typically declines when kids are <a href="https://doi.org/10.1348/0261510041552710">given these kinds of questions</a>.</p>
<p>If investigators struggle to gain information from young children, they may resort to leading questions that suggest details the child has not already mentioned, such as asking about touching when the child has not brought up physical contact. Often, young children will comply with the suggestion of the interviewer <a href="https://doi.org/10.1146/annurev-lawsocsci-110413-030913">even if it is untrue</a>. They may then <a href="https://doi.org/10.1006/jecp.2000.2610">incorporate that misinformation into their subsequent accounts</a> of the crime.</p>
<p>Sticking to a structured interview format makes investigators less likely to fall back on questions that are <a href="https://doi.org/10.1002/acp.1489">suggestive or pose limited options</a>.</p>
<p><iframe id="7xwLa" class="tc-infographic-datawrapper" src="https://datawrapper.dwcdn.net/7xwLa/2/" height="400px" width="100%" style="border: none" frameborder="0"></iframe></p>
<p>The <a href="https://www.nichd.nih.gov">National Institute of Child Health and Human Development</a> provides one <a href="https://nichdprotocol.com/">evidence-based protocol</a> investigators can follow when working with young witnesses. It takes away some of the guesswork on the part of the investigator and ensures open-ended prompts are used before reverting to more focused questions. It also guides investigators to include practice interviews and rapport-building, both of which <a href="https://doi.org/10.1002/9780470773291">improve interview performance</a>, increasing the quality and quantity of information provided.</p>
<p>However, interviewers <a href="https://doi.org/10.1037/amp0000039">need regular training workshops</a> to maintain best practices.</p>
<h2>Setting up better lineup procedures</h2>
<p>After a child eyewitness has described an alleged perpetrator to the authorities, the child may be asked to look through a photo lineup. Usually, the lineup contains someone the police consider to be a suspect along with several people the police know to be innocent.</p>
<p>Lab research suggests that children as young as 6 can be just as accurate as adults when presented with a lineup that contains the alleged perpetrator, typically scoring accuracy rates of <a href="https://psycnet.apa.org/record/2014-08273-006">at least 60%</a>. However, when shown a lineup that doesn’t include the target, children are significantly more likely than adults to <a href="https://doi.org/10.1080/1068316X.2013.793334">make a false identification</a>. Researchers suspect children <a href="https://doi.org/10.1007/s11896-011-9089-8">feel pressured into making a selection</a> and are less aware of the potential consequences of false identifications.</p>
<p><iframe id="7LJ5Q" class="tc-infographic-datawrapper" src="https://datawrapper.dwcdn.net/7LJ5Q/2/" height="400px" width="100%" style="border: none" frameborder="0"></iframe></p>
<p><a href="https://doi.org/10.1002/acp.1511">One method</a> that works to reduce false identification rates is to add an additional photo consisting of a silhouette with a question mark to the lineup. In this situation, children are told to point to the silhouette card if they do not see the target in the lineup. In multiple studies, the silhouette card reduced false identifications while <a href="https://doi.org/10.1002/acp.2870">not reducing the likelihood of a witness’s making a correct identification</a> in the lineup. </p>
<h2>When children are better witnesses than adults</h2>
<p>Children are more <a href="https://doi.org/10.1006/jecp.2000.2610">vulnerable to external pressures</a>, such as leading questions. And their memories are more likely to be tainted by post-event misinformation. But they are less likely to have their interpretation of an event <a href="https://doi.org/10.3758/s13421-010-0043-2">influenced by assumptions</a>, previous experiences, prior knowledge or stereotypes than grown-ups are.</p>
<p>For instance, adults in research studies are more likely than children to <a href="https://www.in-mind.org/article/children-are-poor-witnesses-or-are-they">misremember that a nonviolent bank robbery involved a weapon</a>. It’s also more common for adults to misreport having read a word on a list of words centered around a particular theme. For example, if the list included the words “dream,” “pillow,” “blanket” and “bed,” then adults would be more likely than children to <a href="https://doi.org/10.3758/s13421-010-0043-2">misremember “sleep” having also been on the list</a>. </p>
<p>This area of research needs further exploration, but it seems when specific information cannot be remembered, adult memories often rely upon gist information – that is, the <a href="https://doi.org/10.1111/j.1467-8624.2009.01373.x">overall structure, but not the specific details</a> – more so than children’s do. This tendency may make <a href="https://www.in-mind.org/article/children-are-poor-witnesses-or-are-they">adults more prone to spontaneous false memories</a> than children are. However, children are still more vulnerable to externally induced false memories, like those that stem from leading questions or learning new information after the event.</p>
<p>Unfortunately, every year in the U.S. thousands of criminal cases rely on children’s testimony in order to bring charges. Understanding the wide range of factors that can affect memory in these young witnesses is of the utmost importance.</p><img src="https://counter.theconversation.com/content/186010/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Ben Cotterill does not work for, consult, own shares in or receive funding from any company or organization that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>Human memory doesn’t work like a video camera, simply recording a scene as it happens. But researchers know how to help children recall information accurately.Ben Cotterill, Lecturer in Psychology, Clemson UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1893152022-08-30T01:53:49Z2022-08-30T01:53:49ZWhen remains are found in a suitcase, forensics can learn a lot from the insects trapped within<figure><img src="https://images.theconversation.com/files/481512/original/file-20220829-14-zfm6r5.JPG?ixlib=rb-1.1.0&rect=9%2C283%2C3249%2C1954&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">
</span> <span class="attribution"><span class="source">Paola Magni</span>, <span class="license">Author provided</span></span></figcaption></figure><p>A crime scene can present itself in any form and size.</p>
<p>In recent weeks, an Aotearoa New Zealand family who’d purchased abandoned goods from a storage locker made the harrowing discovery of two sets of human remains <a href="https://www.theguardian.com/world/2022/aug/26/police-identify-two-children-whose-remains-were-found-in-suitcases-in-new-zealand">hidden inside two suitcases</a>.</p>
<p>Sadly, this is not a unique case – bodies of murder victims are found in suitcases with astonishing regularity. But they present a particular challenge for police investigating the crime, which is where forensic science comes in.</p>
<h2>Why suitcases?</h2>
<p>Forensic case history and crime news are sadly full of bodies found in suitcases, bags, wheelie bins, car trunks, fridges and freezers. Examples of such finds include a suitcase in a <a href="https://www.theguardian.com/world/2015/jun/01/womans-body-found-in-suitcase-left-for-month-at-tokyo-train-station">busy Tokyo train station</a> in 2015, <a href="https://www.news.com.au/world/north-america/investigation-after-teens-in-tiktok-video-find-body-parts-in-suitcase-at-seattle-beach/news-story/886c1e58057108d68f5a36e18f3f60a2">a suitcase on a Seattle beach</a> in 2020, and the 2019 case of human remains in a suitcase left on the side of <a href="https://www.9news.com.au/national/60-minutes-karlie-pearce-stevenson-khandalyce-pearce-body-in-suitcase-murder/dd21ed75-5f16-4511-989b-11110b9a0814">a South Australian highway</a>. </p>
<p>There’s a simple reason why suitcases are so common in these situations. While most crime movies depict bodies abandoned above ground or buried in clandestine shallow graves, in reality murder victims are more often concealed in items arranged at the last minute.</p>
<p>These are things that are easy to obtain, accessible, large enough to fit a body, and easy to transport (preferably with wheels). They may also hide the smell of decomposition for a time – useful for the criminal to find an alibi or disappear. </p>
<p>Forensic researchers call such places “limited access environments”, because they limit, delay or totally impede one of the natural steps that happen after death: the arrival of hordes of insects.</p>
<p>The job of scientists like <a href="https://academic.oup.com/jinsectscience/article/13/1/78/1075838">forensic entomologists</a> is to assist crime investigation, but also to develop research that makes this task less difficult.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/forensic-entomology-the-time-of-death-is-everything-2037">Forensic entomology: the time of death is everything</a>
</strong>
</em>
</p>
<hr>
<h2>Insects are key</h2>
<p>In a criminal investigation involving a decomposing body, forensic entomologists can use insects to help <a href="https://pubmed.ncbi.nlm.nih.gov/32876421/">estimate the time since death</a>, retrace the movements of criminals and victims, and <a href="https://theconversation.com/flies-maggots-and-methamphetamine-how-insects-can-reveal-drugs-and-poisons-at-crime-scenes-176981">identify the presence of drugs</a> and <a href="https://pubmed.ncbi.nlm.nih.gov/34591184/">foreign DNA</a>.</p>
<p>Carrion insects – such as blue and green bottle <a href="https://www.britannica.com/animal/blow-fly-insect">blowflies</a>, <a href="https://www.qm.qld.gov.au/Explore/Find+out+about/animals+of+queensland/insects/flies/common+species/flesh+flies">flesh flies</a>, <a href="https://australian.museum/learn/animals/insects/house-fly/">house flies</a> and <a href="https://nhm.org/stories/coffin-fly">coffin flies</a> – have highly specialised olfactory systems they use to detect the smell of decomposition.</p>
<figure class="align-center ">
<img alt="An iridescent blue-green fly sitting on a green lead" src="https://images.theconversation.com/files/481529/original/file-20220829-27-jaofjl.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/481529/original/file-20220829-27-jaofjl.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=398&fit=crop&dpr=1 600w, https://images.theconversation.com/files/481529/original/file-20220829-27-jaofjl.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=398&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/481529/original/file-20220829-27-jaofjl.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=398&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/481529/original/file-20220829-27-jaofjl.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=501&fit=crop&dpr=1 754w, https://images.theconversation.com/files/481529/original/file-20220829-27-jaofjl.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=501&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/481529/original/file-20220829-27-jaofjl.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=501&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Green bottle blowflies are a common carrion insect.</span>
<span class="attribution"><span class="source">dani daniar/Shutterstock</span></span>
</figcaption>
</figure>
<p>If a cadaver is left undisturbed on the ground in a temperate environment, carrion insects will soon colonise it, attracted by the smells produced by the bacteria-mediated <a href="https://www.theguardian.com/science/neurophilosophy/2015/may/05/life-after-death">decay process</a>. Within a few hours, the insects will lay eggs on the body’s orifices and wounds, and the tiny larvae hatched from them will start consuming the body.</p>
<p>But a suitcase physically limits access for the insects. And so far, forensic research on how insect involvement changes in such limited access environments has received little attention.</p>
<p>To date, only two pilot studies on decomposition process in suitcases have been completed, <a href="https://pubmed.ncbi.nlm.nih.gov/24747669/">one in the United Kingdom</a> and another by our team <a href="https://irispublishers.com/gjfsm/fulltext/the-effect-of-suitcase-concealment-on-insect-colonization-a-pilot-study-in-western-australia.ID.000513.php">in Western Australia</a>. Both studies show carrion insects are extremely resourceful when it comes to getting access to concealed bodies.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/forensic-science-isnt-reliable-or-unreliable-it-depends-on-the-questions-youre-trying-to-answer-123020">Forensic science isn't 'reliable' or 'unreliable' – it depends on the questions you're trying to answer</a>
</strong>
</em>
</p>
<hr>
<h2>Suitcases in the bush</h2>
<p>Hidden in a patch of bushland in Western Australia, we are currently running the largest-ever experiment on decomposition process in suitcases and wheelie bins, with almost 70 samples.</p>
<figure class="align-center ">
<img alt="An open air area under a tin shed with rainbow coloured suitcases and small wheelie bins in a grid pattern" src="https://images.theconversation.com/files/481528/original/file-20220829-18-cbl87o.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/481528/original/file-20220829-18-cbl87o.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=450&fit=crop&dpr=1 600w, https://images.theconversation.com/files/481528/original/file-20220829-18-cbl87o.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=450&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/481528/original/file-20220829-18-cbl87o.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=450&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/481528/original/file-20220829-18-cbl87o.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=566&fit=crop&dpr=1 754w, https://images.theconversation.com/files/481528/original/file-20220829-18-cbl87o.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=566&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/481528/original/file-20220829-18-cbl87o.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=566&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Suitcases and wheelie bins with stillborn piglets are being used in the largest limited access environment study to date.</span>
<span class="attribution"><span class="source">Paola Magni</span>, <span class="license">Author provided</span></span>
</figcaption>
</figure>
<p>This first-of-its-kind work will provide useful data to investigate similar cases around the world. Each suitcase and wheelie bin contains a stillborn piglet, simulating a dead body; controls are placed in the environment for comparison. We have placed instruments for recording temperature, humidity and amount of rain both in the field and inside the containers.</p>
<p>The experiment started in early winter 2022 and will end in the summer; the first data will be presented in the world’s largest forensic science conference in February 2023.</p>
<p>Despite an initial delay in insect access during the cold and rainy WA winter, within a month of placing the suitcases we have observed egg clusters of blowflies on and around the suitcase zippers. </p>
<figure class="align-center ">
<img alt="Close up of a black suitcase zipper showing white specks of insect eggs" src="https://images.theconversation.com/files/481509/original/file-20220829-25-4cjaya.JPG?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/481509/original/file-20220829-25-4cjaya.JPG?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=450&fit=crop&dpr=1 600w, https://images.theconversation.com/files/481509/original/file-20220829-25-4cjaya.JPG?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=450&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/481509/original/file-20220829-25-4cjaya.JPG?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=450&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/481509/original/file-20220829-25-4cjaya.JPG?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=566&fit=crop&dpr=1 754w, https://images.theconversation.com/files/481509/original/file-20220829-25-4cjaya.JPG?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=566&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/481509/original/file-20220829-25-4cjaya.JPG?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=566&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Insects will lay eggs on the surface of limited access environments, so their offspring can reach the contents within.</span>
<span class="attribution"><span class="source">Paola Magni</span>, <span class="license">Author provided</span></span>
</figcaption>
</figure>
<p>As we opened the suitcases at set intervals, we found the larvae of blowflies, along with coffin flies and some beetles active in the remains. This means the offspring of large flies and beetles must reach the body through the teeth of the zipper. Meanwhile, smaller flies can cross through the zipper as adults, and lay their eggs directly on the decomposing remains.</p>
<p>Once larvae complete their life cycle and emerge as adult flies, none of them can escape the suitcase. These trapped insects represent a rich source of information, as we know the habits and growth rates of various species, and can find toxicology data preserved in their exoskeletons.</p>
<p>From this, a forensic entomology expert can infer the time or season of death, possible relocation of the body, and assist in the interpretation of the causes and circumstances of death.</p>
<p>The investigation of human remains in a suitcase can often represent a Pandora’s box, full of complicated problems. But with the help of a humble carrion-eating fly trapped within, we gain a treasure trove of vital information that can help us solve crimes.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/identifying-the-dead-after-mass-disasters-is-a-crucial-part-of-grieving-heres-how-forensic-experts-do-it-180616">Identifying the dead after mass disasters is a crucial part of grieving. Here's how forensic experts do it</a>
</strong>
</em>
</p>
<hr>
<img src="https://counter.theconversation.com/content/189315/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Research ongoing is performed in collaboration with Miss Hannah Andrews and Prof. Ian Dadour.</span></em></p>The remains of murder victims often turn up in suitcases, bins, and similar items. Forensic researchers in Australia are leading the way in helping to solve such cases.Paola A. Magni, Senior Lecturer in Forensic Science, Murdoch UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1854472022-06-22T14:53:15Z2022-06-22T14:53:15ZHow Nairobi police failures let people get away with murder<figure><img src="https://images.theconversation.com/files/469994/original/file-20220621-17-iswo86.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">A protest against police brutality outside parliament buildings in Nairobi.
</span> <span class="attribution"><span class="source">Patrick Meinhardt/AFP via Getty Images</span></span></figcaption></figure><p>At least <a href="https://www.standardmedia.co.ke/counties/article/2001361964/how-police-get-away-with-murder-report">one person gets killed every two days</a> in Kenya’s capital city, Nairobi. Most of these cases <a href="https://www.theguardian.com/global-development/2021/aug/17/the-wounds-wont-heal-kenyas-agonising-wait-for-justice-on-killings-by-police">are never resolved</a>. Only 94 murder cases were registered in Nairobi courts in 2021.</p>
<p>Nairobi is Kenya’s most populous city with more than <a href="https://www.knbs.or.ke/2019-kenya-population-and-housing-census-results/">four million people</a>. Like other major cities across Africa, it grapples with crime amid the strained provision of policing services. Kenya was ranked fourth in the <a href="https://www.statista.com/statistics/1223810/countries-with-the-highest-organized-crime-index-in-africa/">2021 Organised Crime Index</a> in Africa, with the <a href="https://www.knbs.or.ke/wp-content/uploads/2022/05/2022-Economic-Survey1.pdf">2022 Economic Survey</a> reporting that Nairobi regularly records the highest number of crimes in the country. </p>
<p>The swift progress the Directorate of Criminal Investigations made in investigating the murder of <a href="https://www.youtube.com/watch?v=PLDXux7pqkw">Dutch businessman Tob Cohen</a>, who had lived in Kenya for years, is largely unheard of. Investigators drawn from the directorate’s homicide unit took <a href="https://www.the-star.co.ke/news/2020-09-01-the-new-detective-in-town-how-dci-is-using-tech-to-crack-crime/">less than two months</a> to unravel Cohen’s 2019 murder and apprehend the perpetrators. </p>
<p>The country’s criminal justice system has a history of failing to crack <a href="https://nation.africa/kenya/news/unsolved-murders-high-profile-cases-yet-to-be-closed-207752">high-profile murders</a>. Cases are characterised by shambolic investigations that eventually lead to their being dismissed due to a lack of evidence.</p>
<p>Unresolved murders that have captured national attention include that of an International Criminal Court witness and whistleblower <a href="https://www.bbc.com/news/world-africa-31799171">Meshack Yebei</a> in 2015. He had been lined up to testify against Kenyan Deputy President William Ruto who was facing charges – that were later dropped – at The Hague-based court.</p>
<p>University student <a href="https://www.standardmedia.co.ke/nairobi/article/2000080721/police-say-varsity-student-keino-was-murdered">Mercy Keino’s body</a> was found along a major Nairobi highway in 2013. Her murderers are yet to face justice. The same holds for <a href="https://www.bbc.com/news/world-africa-40807425">Chris Msando</a>, an elections official who was tortured and killed just weeks before Kenya’s 2017 poll.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/justiceforsheila-highlights-the-precarious-lives-of-queer-people-in-kenya-183102">#JusticeForSheila highlights the precarious lives of queer people in Kenya</a>
</strong>
</em>
</p>
<hr>
<p>Several challenges lie behind the failure of policing agencies to unravel murder cases. These include: poor evidence gathering; mistreatment and manhandling of potential witnesses; police negligence and recklessness; a lack of forensic capability; a poor legal and regulatory environment; and accusations of police involvement in extra-judicial killings.</p>
<p>Based on <a href="https://repository.kippra.or.ke/bitstream/handle/123456789/2745/policing.pdf?sequence=1&isAllowed=y">my research</a> on public sector reforms and policing in Kenya, I believe that the situation can be reversed. For this to happen, however, the <a href="https://www.npsc.go.ke/about-us/">National Police Service</a> must fully implement policing reforms that have been ongoing for the last 12 years.</p>
<h2>The challenges</h2>
<p><strong>Poor evidence gathering and mistreatment of potential witnesses:</strong> Under Kenya’s National Police Service <a href="https://www.nationalpolice.go.ke/downloads/category/5-acts.html">regulations</a>, the first responders at a crime scene are tasked with securing it for the collection of forensic evidence. However, this often doesn’t happen. It is common to see community members crowding around crime scenes, contaminating crucial evidence. </p>
<p>Witnesses are also critical to court processes. But there have been cases of police officers <a href="https://pettyoffences.org/kenyadrunk-and-disorderly-poor-mans-offence-a-cash-cow-for-police/">rounding up and mishandling anybody</a> at a crime scene. This includes potential witnesses, which makes them reluctant to cooperate with investigators. </p>
<p>Ideally, the details and contacts of potential witnesses ought to be recorded before they leave the scene. And the police must avoid detaining witnesses without justifiable reason.</p>
<p><strong>Police incompetence and recklessness:</strong> Police officers have been called out by the courts for carrying out <a href="https://www.standardmedia.co.ke/nairobi/article/2001327141/how-police-bungle-open-and-shut-murder-cases">shoddy investigations</a> or deliberately failing to submit critical evidence. </p>
<p>An example involves the killing of a member of parliament, <a href="https://nation.africa/kenya/blogs-opinion/opinion/how-police-bungle-probes-from-the-word-go-1067846">George Muchai,</a> and his three aides in 2015. The four men were <a href="https://nairobinews.nation.africa/witness-this-is-how-mp-muchai-was-killed/">shot and killed</a> on the streets of Nairobi. In court, however, police officers issued contradicting information on what happened. </p>
<p>In yet other cases, the courts have faulted police officers for relying on <a href="https://www.kenyans.co.ke/news/40149-suspect-3-murders-set-free-after-police-bungle-investigation">rumours and innuendo</a>. This has often resulted in acquittals due to a lack of evidence or even the prosecution of innocent suspects. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/why-violence-is-a-hallmark-of-kenyan-policing-and-what-needs-to-change-139878">Why violence is a hallmark of Kenyan policing. And what needs to change</a>
</strong>
</em>
</p>
<hr>
<p><strong>Lack of forensic capability:</strong> Kenya has finally launched a <a href="https://www.president.go.ke/2022/06/13/president-kenyatta-officially-opens-dci-national-forensic-laboratory/">forensic laboratory</a> after a nearly 20-year delay caused by various <a href="https://nation.africa/kenya/blogs-opinion/blogs/why-newly-launched-dci-national-forensic-laboratory-was-overdue-3853436">corruption scandals</a>. Investigators previously relied on forensic laboratories in <a href="https://www.standardmedia.co.ke/national/article/2001447864/uhuru-kenyatta-launches-forensic-lab-ends-two-decade-wait-for-change">South Africa or Europe</a>. </p>
<p>In most cases, the cost of shipping samples abroad was borne by the families of victims, and it could take months to get results. </p>
<p><strong>Poor legal and regulatory environment:</strong> The National Police Service doesn’t have an official policy that guides officers on how to interact with communities. Its <a href="https://www.nationalpolice.go.ke/downloads/category/5-acts.html">Service Standing Orders</a> are archaic. They are not aligned with the constitution of Kenya, which spells out the rights of citizens even during emergencies. There are cases in which police officers have used <a href="https://www.africanews.com/2022/06/03/kenya-four-shot-dead-in-protest-against-dangerous-wildlife/">live ammunition</a> on unarmed citizens, alleging self defence. </p>
<p><strong>Inadequate data:</strong> Kenya doesn’t have a national crime register that would make it easier for policing agencies to identify habitual criminals within communities. </p>
<p><strong>Allegations of police involvement in extra-judicial killings:</strong> Police officers in Kenya have been <a href="https://www.hrw.org/news/2020/04/22/kenya-police-brutality-during-curfew">accused</a> of extra-judicial killings, making it nearly impossible for the public to expect them to be neutral during investigations and subsequent trials of suspects.</p>
<p>Many of the killings that are reported and documented involve the <a href="https://www.hrw.org/news/2020/02/20/kenya-no-letup-killings-nairobi-police">deaths of victims of police-related actions</a>. In such cases, investigations are often <a href="https://www.one.org/africa/blog/ndwiga-brothers-death-police-brutality-kenya/">bungled from the beginning</a> due to the ‘blue code of silence’ common within policing agencies. This sees many crimes involving police officers <a href="http://kenyalaw.org/caselaw/cases/view/193506/">deliberately covered up</a> by their colleagues. </p>
<p>A public oversight body, the <a href="http://www.ipoa.go.ke/">Independent Policing Oversight Authority </a>, is mandated to investigate cases of police misconduct. However, it has often met resistance from policing agencies in carrying out its work.</p>
<p>In addition, the country is yet to effect the <a href="https://www.knchr.org/Portals/0/Handbook%20On%20The%20National%20Coroners%20Service%20Act%2C%202017_2018.pdf">National Coroners Service Act 2017</a>. This law transfers the investigation of unnatural and violent deaths, including of people in police custody and prisons, from policing agencies to the office of a coroner general. </p>
<h2>The solutions</h2>
<p>First, evidence gathering and the treatment of witnesses needs to improve. The National Police Service must restore public confidence in its ability to investigate crimes. Police officers need to treat communities as partners in crime resolution, not as suspects.</p>
<p>Second, police incompetence needs to be addressed. The Internal Affairs Unit of the police rarely makes its findings on cases of misconduct open. Neither does it say what action was taken. The unit needs to work with communities to build public trust and ensure that cases of police negligence, recklessness and misconduct are addressed.</p>
<p>Third, forensic capabilities need to be improved. The <a href="https://www.president.go.ke/2022/06/13/president-kenyatta-officially-opens-dci-national-forensic-laboratory/">National Forensic Laboratory</a> is expected to improve officers’ ability to resolve complex crimes and support the criminal justice system through evidence-based investigations. </p>
<p>With changes in technology, the police service must ensure that the forensic laboratory stays updated and that it appoints officers with high integrity.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/how-do-police-forensic-scientists-investigate-a-case-a-clandestine-gravesite-recovery-expert-explains-171959">How do police forensic scientists investigate a case? A clandestine gravesite recovery expert explains</a>
</strong>
</em>
</p>
<hr>
<p>Fourth, Kenya needs a stronger regulatory environment. The National Coroners Service Act, if implemented, <a href="https://www.amnestykenya.org/establish-coroner-generals-office-to-help-solve-rising-murder-mysteries/">is key</a>. This law would ensure that many unresolved murders are dealt with through forensic science.</p>
<p>Lastly, the country must address the issue of extra-judicial killings. This can be done by fixing weak forensic laws that help abet unlawful police killings and enable murder suspects to outmanoeuvre the law by either compromising investigators or court officials. </p>
<p>An audit of extra-judicial killings needs to be undertaken, leading to open and independent vetting of all police officers who come into contact with communities. </p>
<p>Continuous training, retraining, reevaluation and reconfiguration of how policing agencies conduct their business is critical. And officers who engage in crime, negligence and murders must be sanctioned heavily and removed from the service.</p><img src="https://counter.theconversation.com/content/185447/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Douglas Lucas Kivoi does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>A host of problems are behind police failures, including poor evidence gathering and the mistreatment of witnesses.Douglas Lucas Kivoi, Principal Policy Analyst, Governance Department, The Kenya Institute for Public Policy Research and Analysis (KIPPRA)Licensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1806162022-04-08T00:28:51Z2022-04-08T00:28:51ZIdentifying the dead after mass disasters is a crucial part of grieving. Here’s how forensic experts do it<p>As Russian forces withdraw from parts of Ukraine, reports have emerged of <a href="https://www.abc.net.au/news/2022-04-07/ukraine-latest-civilian-deaths-mariupol-russia-kyiv-east/100972410">thousands dead</a> and <a href="https://www.abc.net.au/news/2022-04-04/ukraine-latest-satellite-mass-grave-bucha-kyiv-peace-talks/100963202">mass graves</a> holding unknown numbers of bodies. </p>
<p>After many people die in human-made or natural “<a href="https://link.springer.com/chapter/10.1007/978-1-59745-099-7_18">mass disasters</a>”, the work of identifying the victims begins. This is a crucial part of the process of grieving the loss of life, and for a community to start recovering from <a href="https://digitalcommons.unl.edu/cgi/viewcontent.cgi?article=1123&context=usuhs">mass trauma</a>.</p>
<p>Forensic experts, which form disaster victim identification teams, have <a href="https://www.interpol.int/content/download/589/file/18Y1344%20E%20DVI_Guide.pdf">standard operating procedures</a> for these situations. These procedures give the best chance of recovering information, successfully identifying remains, and providing initial psychological support to victims’ families. </p>
<p>Many nations have <a href="https://www.sciencedirect.com/science/article/abs/pii/S1875176808002096">their own disaster victim identification teams</a>. However, as the world becomes more connected and disasters grow more complex, international cooperation is on the rise. </p>
<h2>How disaster victim identification works</h2>
<p>Disaster victim identification experts gather the victims’ data at the scene. They then obtain dental records, DNA, fingerprints and other invidual-specific information, such as tattoos and prostheses, during the post-mortem examination. </p>
<p><a href="https://pubmed.ncbi.nlm.nih.gov/16546337/">Information about the victims’ lives</a> is recovered via various sources. These range from the typical medical records and collaboration with suspected victims’ families, to <a href="https://pubmed.ncbi.nlm.nih.gov/27138238/">photographs posted on social media</a> and <a href="https://www.sundaypost.com/fp/forensic-jeweller/social">personal items such as jewellery</a>.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/how-do-we-identify-human-remains-121315">How do we identify human remains?</a>
</strong>
</em>
</p>
<hr>
<p>All of these data are used to confirm the victim’s identity, so the remains can be released to the family.</p>
<h2>Dignity, respect and care</h2>
<p>The correct storage of bodies is a priority. While there is a “best practice” procedure, it must often be adapted to the circumstances.</p>
<p>For example, in Ukraine the United Nations reports <a href="https://www.ohchr.org/en/news/2022/04/ukraine-civilian-casualty-update-7-april-2022">1,611 civilian deaths confirmed as of April 7</a>. There are <a href="https://www.abc.net.au/news/2022-04-07/ukraine-latest-civilian-deaths-mariupol-russia-kyiv-east/100972410">unconfirmed reports of thousands more</a>.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/reliable-death-tolls-from-the-ukraine-war-are-hard-to-come-by-the-result-of-undercounts-and-manipulation-179905">Reliable death tolls from the Ukraine war are hard to come by – the result of undercounts and manipulation</a>
</strong>
</em>
</p>
<hr>
<p>When many people die in a short time, and in an active war zone, managing their remains <a href="https://www.abc.net.au/news/2020-12-05/serbia-unearths-mass-grave-from-kosovo-war/12953754">can be difficult</a>.</p>
<p>The best storage procedure would use refrigerated containers or dry ice to keep the bodies cool or frozen. Temporary burials can be considered if electricity is an issue, and for the health and safety of survivors. </p>
<p>If bodies are to be moved or buried, they must be documented first with photographs, fingerprints and DNA samples. Individual and marked body bags are also important, as are geocoding systems to precisely identify the burial location of each individual.</p>
<p>Disaster victim identification teams aim to put in place the highest possible quality standards. This allows victims to be treated with dignity and respect, giving their families the best opportunity to obtain answers as quickly as possible.</p>
<h2>A global problem</h2>
<p>Mass disasters affect multiple countries, and the victims are frequently citizens of different nations.</p>
<p>International organisations such as <a href="https://www.interpol.int/en/How-we-work/Forensics/Disaster-Victim-Identification-DVI">Interpol</a> and the <a href="https://www.icmp.int/what-we-do/technical-assistance/disaster-victim-identification/">International Commission on Missing Persons</a> commonly offer technical and other assistance in such cases, especially in less-developed countries.</p>
<p>However, greater international cooperation between disaster victim identification teams is needed. This is to support in-country authorities and assure ethical, transparent and humane treatment of all victims. </p>
<p>A key part of this cooperation will be strategic planning ahead of disasters, and establishing protocols for bringing in specialists and resources when disasters occur.</p>
<p>There have been several noteworthy projects aiming to test the joint response capacities of different countries. In 2019 the Austrian Red Cross ran <a href="https://redcross.eu/projects/disaster-preparedness-among-neighbours-in-the-alps">a large exercise in the European Alps</a> involving rescue organisations from several neighbouring countries.</p>
<p>In Australia, the <a href="https://pfes.nt.gov.au/sites/default/files/uploads/files/2019/drum-august-2010.pdf">Disaster Victim Identification Practitioner’s Course</a> held in the Northern Territory brings together experts from every state. The Australian Border Force also works with the Malaysia Coast Guard in <a href="https://operationredback.com/">Operation Redback</a>, which aims to combat maritime crime and prevent vulnerable people from risking their lives at sea.</p>
<p>Some mass disaster exercises require <a href="https://www.bbc.com/news/uk-35686269">thousands of volunteers</a> to play the role of victims for a drill that can run for several consecutive days. </p>
<figure class="align-center ">
<img alt="A group of students posing for a photo." src="https://images.theconversation.com/files/456926/original/file-20220407-24-z2qlo.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/456926/original/file-20220407-24-z2qlo.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=450&fit=crop&dpr=1 600w, https://images.theconversation.com/files/456926/original/file-20220407-24-z2qlo.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=450&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/456926/original/file-20220407-24-z2qlo.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=450&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/456926/original/file-20220407-24-z2qlo.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=566&fit=crop&dpr=1 754w, https://images.theconversation.com/files/456926/original/file-20220407-24-z2qlo.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=566&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/456926/original/file-20220407-24-z2qlo.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=566&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Students from Murdoch University and Universiti Kebangsaan Malaysia with forensic experts.</span>
<span class="attribution"><span class="source">Paola Magni</span></span>
</figcaption>
</figure>
<p>In the past few years I have developed an educational program funded by the Australian government’s <a href="https://www.dfat.gov.au/people-to-people/new-colombo-plan">New Colombo Plan</a>. This program brings together Australian and Malaysian forensic students with international experts to <a href="https://www.murdoch.edu.au/news/articles/forensic-students-learn-cross-cultural-csi-skills-in-malaysia">work on a simulated mass disaster scenario</a>. Students who have taken part in this intercultural experience have improved their practical and communication skills, <a href="https://journals.sfu.ca/jalt/index.php/jalt/article/view/141">developed awareness and long-lasting international connections</a>.</p>
<p>Projects like this one should be a priority of every country. All nations should develop plans to prepare the present and future generations of investigators to help heal the physical and psychological scars caused by a disaster.</p><img src="https://counter.theconversation.com/content/180616/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Paola Magni has received funds from the Australian Government New Colombo Plan Mobility Grant.</span></em></p>Identifying the victims of a mass casualty event is a crucial part of grieving and community healing.Paola A. Magni, Senior Lecturer in Forensic Science, Murdoch UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1769812022-02-28T19:14:05Z2022-02-28T19:14:05ZFlies, maggots and methamphetamine: how insects can reveal drugs and poisons at crime scenes<figure><img src="https://images.theconversation.com/files/448798/original/file-20220228-4024-xsiszf.jpeg?ixlib=rb-1.1.0&rect=0%2C0%2C2389%2C1580&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">
</span> <span class="attribution"><span class="source">Shutterstock</span></span></figcaption></figure><p>The oldest book of zoology was <a href="https://en.wikipedia.org/wiki/Urra%3Dhubullu">published on clay tablets more than 3,600 years ago</a>, and reported the names of 396 types of wild animals known at the time. Ten of them were different kinds of fly. </p>
<p>Flies have lived alongside humans since the dawn of history, feeding on our bodily fluids and other organic waste such as meat and vegetable scraps. When an adult female blowfly finds some juicy decaying material – typically a carcass – she may lay hundreds of eggs or tiny maggots in it.</p>
<p>So flies use us, our products, our waste, and even the bodies of our dead. How can we use them in return?</p>
<p>One way is <a href="https://pubmed.ncbi.nlm.nih.gov/14991142/">the science of forensic entomology</a>. At a crime scene, flies and maggots can be used to determine how long it has been since a person or animal died, if they have been moved or neglected prior to death – and what drugs or poisons they had in their system.</p>
<h2>From flies on a sickle to modern forensics</h2>
<p>The first recorded instance of flies helping out in a murder case was during the 13th century. </p>
<p>A Chinese judge named <a href="https://en.wikipedia.org/wiki/Song_Ci">Sung T'zu</a> was sent to investigate a fatal stabbing in a rice field. </p>
<p>At the scene of the murder, he asked all the workers to lay down their sickles. After a short time, several flies swarmed on one of the sickles, attracted by the smell of invisible traces of blood. </p>
<p>Sung T'zu wrote about the case in <a href="https://www.jstor.org/stable/10.3998/mpub.19945">The Washing Away of Wrongs</a>, the oldest known book on forensic medicine, printed in 1247. He showed how thinking “outside the box” using clues from nature can help in forensic investigations. </p>
<p>It was several more centuries before the scientific method was applied to the use of flies in criminal investigations. The discipline of forensic entomology as we know it was not born until 1894, with the publication of <a href="https://collections.nlm.nih.gov/catalog/nlm:nlmuid-28421710R-bk">Carrion Fauna: The Application of Entomology to Legal Medicine</a>, by the French army veterinarian and entomologist Jean Pierre Mégnin.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/meet-the-maggot-how-this-flesh-loving-butt-breathing-marvel-helps-us-solve-murders-166518">Meet the maggot: how this flesh-loving, butt-breathing marvel helps us solve murders</a>
</strong>
</em>
</p>
<hr>
<p>Since then, research on blowfly growth rates, decomposition patterns in different environments and use of blowflies to clean up the wounds (<a href="https://pubmed.ncbi.nlm.nih.gov/32825736/">debridement or “maggot” therapy</a>) have gained momentum. </p>
<p>Often flies can help estimate the time of death, as an entomologist can identify the flies or maggots, look at environmental conditions such as temperature, and thereby calculate the amount of time they have been growing.</p>
<p>Forensic entomologists are often involved at crime scenes, and <a href="https://pubmed.ncbi.nlm.nih.gov/9670502/">many suspicious deaths of humans and animals</a> have been solved with the help of insects. </p>
<h2>You are what you eat</h2>
<p>However, drugs and poisons can also affect how attractive blowflies find the carcass, and how quickly maggots grow on it. This means we often need to identify what drugs or poisons we are dealing with.</p>
<p>This can be found by analysing blood, urine, solid tissue or hairs from the dead body. But in some cases all that remains is a skeleton, so these are unavailable.</p>
<p>In these cases, we need to think outside the box, just like Sung T'zu. The old adage says “you are what you eat”, so insects feeding on a body should take in substances from the body and store them in their own bodies.</p>
<p>Furthermore, insects’ hard external skeleton is made of chitin, a comparable substance to the keratin protein from which hair is made. Similarly to hair keratin, insect chitin stores drugs for a long time, which is helpful for toxicological analyses. </p>
<figure class="align-center ">
<img alt="" src="https://images.theconversation.com/files/448804/original/file-20220228-23-ls9wc8.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/448804/original/file-20220228-23-ls9wc8.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/448804/original/file-20220228-23-ls9wc8.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/448804/original/file-20220228-23-ls9wc8.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/448804/original/file-20220228-23-ls9wc8.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/448804/original/file-20220228-23-ls9wc8.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/448804/original/file-20220228-23-ls9wc8.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Insect exoskeletons are made of chitin, a substance that stores traces of drugs for a long time.</span>
<span class="attribution"><span class="source">Shutterstock</span></span>
</figcaption>
</figure>
<p>Insects collected from a carcass can be used as alternative toxicological specimens in situations where traditional sources are not available. Knowing the effect of the toxins on the life cycles of the flies can be used to adjust what we know about their growth rates.</p>
<p>In the early 1970s, the Finnish biologist Pekka Nuorteva showed <a href="https://www.jstor.org/stable/23731650">mercury from a fish carcass could transfer to carrion flies</a>. A few years later a similar analysis was used to determine whether a murder victim had lived in a polluted area. By 1977 the hybrid discipline of entomotoxicology (entomology + toxicology) became a reality. </p>
<p>When tissues and fluids are unavailable, insects are more reliable than hair to detect drug use just before death. They are also easier to analyse than decomposed matter. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/mummies-have-had-a-bad-wrap-its-time-for-a-reassessment-48729">Mummies have had a bad wrap – it's time for a reassessment</a>
</strong>
</em>
</p>
<hr>
<p>What’s more, they are available for a very long time. Empty fly puparial cases (cocoons left in the environment by the adult fly after its metamorphosis) as well as skin of carrion beetles have even been used for <a href="https://academic.oup.com/jme/article/52/5/755/831468?login=false">toxicological studies</a> of <a href="https://www.ojp.gov/ncjrs/virtual-library/abstracts/isolation-amitriptyline-and-nortriptyline-fly-puparia-phoridae-and">mummified bodies</a> found weeks, months, or even years after death. </p>
<p>And since <a href="https://www.sciencedirect.com/science/article/abs/pii/037907389390280N">cocaine has been detected in the hair of
3,000-year-old Peruvian mummies</a>, it might also be possible to detect drugs in the insects associated with ancient skeletal remains.</p>
<h2>Ice and antifreeze</h2>
<p>Since the beginning of the COVID-19 pandemic, there has been an <a href="https://www.commonwealthfund.org/blog/2022/overdose-deaths-surged-first-half-2021-underscoring-urgent-need-action">increase in drug overdose deaths</a> and also <a href="https://www.aaha.org/publications/newstat/articles/2020-07/big-spike-in-pandemic-related-pet-poisonings/">pet poisonings</a>. </p>
<p>My research group is developing ways to detect a range of drugs and other substances commonly found in the suspicious death of humans and animals.</p>
<p>One of these is <a href="https://pubmed.ncbi.nlm.nih.gov/24905151/">methamphetamine</a>, a large problem for Australian law enforcement and health authorities. Another is <a href="https://pubmed.ncbi.nlm.nih.gov/29753971/">ketamine</a>, a sedative and hallucinogen sometimes used to facilitate sexual assault. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/ice-age-the-rise-of-crystal-meth-in-australia-26052">Ice age: the rise of crystal meth in Australia</a>
</strong>
</em>
</p>
<hr>
<p>We have also studied the effect of cheap, dangerous, and readily available poisons on blowflies, including</p>
<ul>
<li><p><a href="https://pubmed.ncbi.nlm.nih.gov/26874739/">nicotine</a>, which can be lethal if ingested from e-cigarette refills or if passed through the skin via nicotine patches</p></li>
<li><p><a href="https://pubmed.ncbi.nlm.nih.gov/29526269/">car antifreeze</a> (ethylene glycol), as it is sometimes used to make home-made alcoholic drinks or consumed by homeless people in winter in the hope to keep themselves warm at night</p></li>
<li><p><a href="https://academic.oup.com/jme/article/55/1/51/4344943">endosulfan</a>, a pesticide often used to make poison baits to kill animals.</p></li>
</ul>
<h2>More to be done</h2>
<p><a href="https://pubmed.ncbi.nlm.nih.gov/21237593/">Many compounds (such as drugs, metals and pesticides)</a> as well as <a href="https://pubmed.ncbi.nlm.nih.gov/28567525/">accelerants and gunshot residues</a> have been detected in insect tissues in a forensic context. However, fewer than 100 such studies have been carried out.</p>
<p>Furthermore, older research often lacks consistency, robust study protocols and method validations. Standard protocols and more sophisticated analytical methods can provide more accurate results that will hold more weight in court.</p><img src="https://counter.theconversation.com/content/176981/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Paola A. Magni does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>Forensic entomologists analyse blowflies and cocoon cases to help solve crimes.Paola A. Magni, Senior Lecturer in Forensic Science, Murdoch UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1749632022-02-07T19:08:45Z2022-02-07T19:08:45ZHow centuries-old bones from Australia’s historic shipwrecks can help us solve crimes<p>Rivers, lakes and the sea frequently host scenes of death and crime. When a body is pulled from a watery grave – due to, for instance, drowning, floods, tsunamis, shipwrecks, air crashes or murder – specialist investigative techniques are used to piece together what may have happened. </p>
<p>This discipline, known as aquatic forensics, brings together knowledge from underwater archaeology, anthropology, marine biology and marine science. But it is still in its infancy and there’s much left to learn.</p>
<p>The investigation of a body recovered from the water is challenging enough, with so much evidence washed (or eaten!) away, and the chemistry of decomposition so profoundly affected by water. But when only the bones or the teeth of a victim are found, the mystery becomes nearly impossible to solve.</p>
<p>To help bridge this knowledge gap, we’ve spent years studying archaeological bones collected from historical shipwrecks that have rested on the seabed for centuries. We’re searching for ways to use recovered bones and teeth to better understand time spent in the sea, and the overall journey of the mortal remains.</p>
<p>Our findings may one day assist forensic investigations on more recent bones, such as when complete or partial skeletons (human or non-human) are recovered from oceans, lakes or rivers – or are just beached on the shore.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/crime-wont-stop-because-of-covid-so-how-should-we-protect-crime-scene-investigators-174870">Crime won't stop because of COVID. So how should we protect crime scene investigators?</a>
</strong>
</em>
</p>
<hr>
<h2>Reconstructing the chain of events</h2>
<p>The study of bones and teeth help investigators learn about the person’s sex and age, and potentially identify a specific individual by studying dental restorations and DNA. In the best case scenario, a facial reconstruction will be be possible. However, sometime we can only determine if it’s not a human bone after all but rather that of an animal.</p>
<figure class="align-right zoomable">
<a href="https://images.theconversation.com/files/443973/original/file-20220202-21-15htshi.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="Artefacts recovered from the site of the Dutch vessel Vergulde Draeck include piles of silver coins." src="https://images.theconversation.com/files/443973/original/file-20220202-21-15htshi.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=237&fit=clip" srcset="https://images.theconversation.com/files/443973/original/file-20220202-21-15htshi.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=818&fit=crop&dpr=1 600w, https://images.theconversation.com/files/443973/original/file-20220202-21-15htshi.jpeg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=818&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/443973/original/file-20220202-21-15htshi.jpeg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=818&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/443973/original/file-20220202-21-15htshi.jpeg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=1028&fit=crop&dpr=1 754w, https://images.theconversation.com/files/443973/original/file-20220202-21-15htshi.jpeg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=1028&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/443973/original/file-20220202-21-15htshi.jpeg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=1028&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Artefacts recovered from the site of the Dutch vessel Vergulde Draeck include piles of silver coins.</span>
<span class="attribution"><a class="source" href="http://www.environment.gov.au/cgi-bin/heritage/photodb/imagesearch.pl?proc=detail;barcode_no=dig005114">Western Australian Museum</a></span>
</figcaption>
</figure>
<p>But special characteristics of bones and teeth and the organisms connected to them can help investigators reconstruct the chain of events that occurred after death and before the recovery. This reconstruction is the object of taphonomy research.</p>
<p>Taphonomy is a scientific term coined in 1940 to describe the processes through which organic remains, such as bone and teeth, are transformed over time and pass from the biosphere (the world of life) to the lithosphere (the world of rocks and dust).</p>
<h2>Shipwreck bones</h2>
<p>Our team has been analysing sheep, pig and cow bones discovered in decayed wooden barrels during underwater archaeological excavations of historical shipwrecks off the coast of Western Australia.</p>
<p>The bones and the teeth of this study are part of the collections of the <a href="https://visit.museum.wa.gov.au/shipwrecks">WA Shipwrecks Museum</a>. </p>
<p>They belong to the underwater archaeological sites of:</p>
<ul>
<li><p>the <a href="https://museum.wa.gov.au/research/research-projects/archaeology/batavia-shipwreck-study-batavia-ships-hull-remains">Batavia</a>, a Dutch East India Company ship wrecked in 1629</p></li>
<li><p>the <a href="https://www.museum.wa.gov.au/maritime-archaeology-db/roaring-40s/vergulde-draeck">Vergulde Draeck</a> a Dutch East India Company ship wrecked in in 1656 </p></li>
<li><p>the <a href="https://www.museum.wa.gov.au/maritime-archaeology-db/wrecks/id-806">Zeewijk</a>, a Dutch East India Company ship wrecked in 1727, and</p></li>
<li><p>the <a href="https://museum.wa.gov.au/research/collections/maritime-archaeology/maritime-shipwrecks/rapid">Rapid</a>, an America-China trader wrecked in 1811.</p></li>
</ul>
<p>The first three were wrecked while sailing towards Jakarta, following what was known as the <a href="https://museum.wa.gov.au/about/latest-news/problem-longitude-relation-discovery-australia">Brouwer Route</a>, whereas Rapid was sailing from Boston to Canton (now Guangzhou).</p>
<p>The wrecks were located between the 1960s and 1970s – some accidentally and some after long research – by recreational divers and underwater archaeologists. The wrecks contained many other artefacts, including piles of silver coins.</p>
<p>Our research has been looking at bones submerged in seawater and/or surrounded by marine sediment for anywhere between 169 and 347 years. The work is ongoing but, so far, we’ve:</p>
<ul>
<li><p><a href="https://onlinelibrary.wiley.com/doi/abs/10.1002/oa.3072">identified special chemical clues</a> or “geochemical fingerprints” of a process known as diagenesis (meaning the changes that occur on skeletal material over time)</p></li>
<li><p><a href="https://onlinelibrary.wiley.com/doi/abs/10.1002/oa.3013">reported</a> new insights into how marine single-celled organisms called foraminifera affect the dissolving spaces inside submerged bone. These microorganisms, largely used for ecological and paleontological studies, can provide a treasure trove of information for investigators trying to work out how much time has passed since death.</p></li>
<li><p>built a better understanding of how <a href="https://pubmed.ncbi.nlm.nih.gov/25538026/">bioerosion by bacteria and coloniser animals such as barnacles</a> affects bones underwater.</p></li>
</ul>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/444444/original/file-20220203-19-mbe8ic.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="Here's a bone sample with tiny microfossils in it. These microorganisms can provide a treasure trove of information for investigators." src="https://images.theconversation.com/files/444444/original/file-20220203-19-mbe8ic.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/444444/original/file-20220203-19-mbe8ic.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=480&fit=crop&dpr=1 600w, https://images.theconversation.com/files/444444/original/file-20220203-19-mbe8ic.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=480&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/444444/original/file-20220203-19-mbe8ic.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=480&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/444444/original/file-20220203-19-mbe8ic.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=603&fit=crop&dpr=1 754w, https://images.theconversation.com/files/444444/original/file-20220203-19-mbe8ic.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=603&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/444444/original/file-20220203-19-mbe8ic.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=603&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Here’s a bone sample with tiny microfossils in it. These microorganisms can provide a treasure trove of information for investigators.</span>
<span class="attribution"><span class="source">Edda Guareschi</span>, <span class="license">Author provided</span></span>
</figcaption>
</figure>
<p>Bones can be found in the sea after a long time only if they have been contained and protected by hard structures, such as the hull of a ship or the cabin of an aircraft. Otherwise, marine animals will attack, scatter and fragment them. Other animals will use them as a shelter.</p>
<p>After a long time within the remnants of a wreck, bones can become enclosed in concretions formed by iron objects that were aboard the ship. As time passes, the chemical elements of the bones change, with the addition of chemical elements normally absent in living bone. </p>
<p>The combination of everything added and removed from bones during their long rest underwater can help investigators reconstruct the events after death. </p>
<p>This knowledge can be <a href="https://www.dailymail.co.uk/news/article-7771557/Human-skull-skeleton-dredged-depths-Thames-belonged-18th-century-convict.html">crucial</a> in forensic investigations.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/444161/original/file-20220202-19-61jsgi.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/444161/original/file-20220202-19-61jsgi.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/444161/original/file-20220202-19-61jsgi.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=450&fit=crop&dpr=1 600w, https://images.theconversation.com/files/444161/original/file-20220202-19-61jsgi.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=450&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/444161/original/file-20220202-19-61jsgi.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=450&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/444161/original/file-20220202-19-61jsgi.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=565&fit=crop&dpr=1 754w, https://images.theconversation.com/files/444161/original/file-20220202-19-61jsgi.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=565&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/444161/original/file-20220202-19-61jsgi.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=565&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">An example of a bone enclosed in a marine concretion, from Rapid (1811).</span>
<span class="attribution"><span class="source">Author provided</span>, <span class="license">Author provided</span></span>
</figcaption>
</figure><img src="https://counter.theconversation.com/content/174963/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Edda Guareschi is Visiting Researcher at the WA Shipwrecks Museum.</span></em></p><p class="fine-print"><em><span>Paola A. Magni does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>We’re searching for ways to use recovered bones and teeth to better understand time spent in the sea, and the overall journey of the mortal remains.Paola A. Magni, Senior Lecturer in Forensic Science, Murdoch UniversityEdda Guareschi, Adjunct Lecturer in Forensic Sciences, Murdoch UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1746002022-01-13T11:25:05Z2022-01-13T11:25:05ZThe science that is helping researchers find the ‘disappeared’ in Latin America<p>In most Latin American countries where there has been a high level of civil conflict over the past few decades, there are still <a href="http://www.desaparecidos.org">huge numbers</a> of missing people due to forced disappearances. In Colombia alone this number is estimated to be more than <a href="https://www.icmp.int/press-releases/profiles-of-the-missing-from-colombia-perspectives-and-priorities-of-families-of-the-disappeared/#:%7E:text=As%20many%20as%20120%2C000%20people,guerrilla%20groups%2C%20and%20organized%20crime.">120,000 people</a> after five decades of bitter insurgency. Many thousands of others have been disappeared across Mexico, Argentina, Chile, El Salvador and Guatemala. </p>
<p>Searching for human remains in South America is hugely challenging, which is often a consequence of the remote locations used, inhospitable search terrain, and the time that has elapsed since the person disappeared, which can be over 40 years. </p>
<figure class="align-center ">
<img alt="Scientists trekking with horses through tropical rainforest" src="https://images.theconversation.com/files/439897/original/file-20220109-33062-1niw9i.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/439897/original/file-20220109-33062-1niw9i.png?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=441&fit=crop&dpr=1 600w, https://images.theconversation.com/files/439897/original/file-20220109-33062-1niw9i.png?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=441&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/439897/original/file-20220109-33062-1niw9i.png?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=441&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/439897/original/file-20220109-33062-1niw9i.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=555&fit=crop&dpr=1 754w, https://images.theconversation.com/files/439897/original/file-20220109-33062-1niw9i.png?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=555&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/439897/original/file-20220109-33062-1niw9i.png?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=555&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">The authors horse trekking (with equipment) through tropical rainforest to a suspected 1980s mass burial site in the grounds of a derelict mountain school.</span>
<span class="attribution"><span class="license">Author provided</span></span>
</figcaption>
</figure>
<p>Trying to locate victims is a very case-specific process – it largely depends on how, when, where and why each victim was killed and who killed them. Since governments are often unwilling to look for bodies, it has often fallen to researchers like us to do it instead.</p>
<p>The generally accepted strategy for searching for remains either <a href="http://dx.doi.org/10.1016/j.earscirev.2012.05.006">on land</a> or <a href="http://dx.doi.org/10.1016/j.earscirev.2017.04.012">under water</a> is a phased investigation of an area that is suspected of having been used for burials. These are often places where it’s not possible just to go in and start digging – first it’s necessary to build up the evidence that would give a strong legal case for securing official permission. </p>
<p>The investigation starts from available background information and satellite information to look for clues as to where bodies might be buried. Ground teams then do controlled studies which usually involve burying pig cadavers as proxies for humans, which over long periods of time allows them to gain insights into how the soil in that area might have responded to human burials. This then allows them to identify places in the suspected burial area that have similar ground characteristics, at which point they can make full ground surveys followed by more intrusive investigations. </p>
<p>Research by the Keele co-authors, with Spanish colleagues at Oviedo University, has used these techniques to <a href="https://doi.org/10.1016/j.forsciint.2018.03.034">successfully locate</a> in 2016 the remains of 26 victims who had been buried in the 1930s in a mountainous region of Asturias province in northern Spain during the <a href="https://en.wikipedia.org/wiki/Spanish_Civil_War">Spanish civil war</a>. More recently an organisation called the <a href="https://en.wikipedia.org/wiki/Argentine_Forensic_Anthropology_Team">Argentine Forensic Anthropology Team</a>, originally set up to search for disappeared victims in that country, has investigated other South American conflicts and recovered the remains of victims of a mass killing in 1981 in <a href="https://www.bbc.co.uk/news/av/stories-59587051">El Salvador</a> using similar techniques. </p>
<h2>Gathering evidence</h2>
<p>In a controlled study, researchers identify test sites that may be similar to those encountered by forensic investigators during the hunt for murder victims. They then replicate what might be encountered by search teams, for example, they simulate murder victims in various burial scenarios. </p>
<p>Though most researchers use pigs as proxies for human cadavers, some use donated bodies where laws allow <a href="https://theconversation.com/coming-to-a-field-near-you-the-body-farms-where-human-remains-decompose-in-the-name-of-science-50561">(not in the UK</a> at present). Pigs are usually used because they are of a similar size to humans and have comparable body tissue-fat ratios, organ sizes and skin types. </p>
<p>These test sites are then surveyed to find out the best method for detecting bodies in that type of environment. This relates to the fact that over time, bodies decompose and release fluids. They become skeletons and the overlying soil compacts. </p>
<p>The diagram below shows different stages of a clandestine grave of a murder victim, with a) showing a fresh burial that simply walking over the site could identify, b) early-stage decomposition that releases gases detectable by search dogs, c) late-stage decomposition that releases conductive fluids detectable by an electrical resistivity survey and, d) skeletonised stage, best detected by ground-penetrating radar (GPR).</p>
<figure class="align-center ">
<img alt="" src="https://images.theconversation.com/files/440256/original/file-20220111-19-15beer8.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/440256/original/file-20220111-19-15beer8.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=219&fit=crop&dpr=1 600w, https://images.theconversation.com/files/440256/original/file-20220111-19-15beer8.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=219&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/440256/original/file-20220111-19-15beer8.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=219&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/440256/original/file-20220111-19-15beer8.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=276&fit=crop&dpr=1 754w, https://images.theconversation.com/files/440256/original/file-20220111-19-15beer8.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=276&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/440256/original/file-20220111-19-15beer8.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=276&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption"></span>
</figcaption>
</figure>
<p>Our research team set up controlled test sites in the campus grounds of Los Llanos and Antonio Nariňo universities in Colombia, which have different tropical, rural and field environments. We simulated burials using pig carcasses in various different burial types. Some were dismembered, some were clothed, some unclothed. These, sadly, are all common burial scenarios in Colombia. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/coming-to-a-field-near-you-the-body-farms-where-human-remains-decompose-in-the-name-of-science-50561">Coming to a field near you? The 'body farms' where human remains decompose in the name of science</a>
</strong>
</em>
</p>
<hr>
<p>Once created, the simulated graves containing the pig carcasses were refilled and monitored for over two years. Monitoring included aerial surveys using cameras and specialist detector equipment on unmanned drones. We also performed ground geophysical surveys using <a href="https://archive.epa.gov/esd/archive-geophysics/web/html/resistivity_methods.html#:%7E:text=Surface%20electrical%20resistivity%20surveying%20is,the%20surrounding%20soils%20and%20rocks.">electrical resistivity</a>, which measures current resistances in the ground with decompositional fluids being an excellent geophysical target – shown below – and GPR which detects buried objects.</p>
<figure class="align-center ">
<img alt="Burial site in Colombia showing electrical equipment being used to detect remains" src="https://images.theconversation.com/files/439898/original/file-20220109-13-4a4va.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/439898/original/file-20220109-13-4a4va.png?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=510&fit=crop&dpr=1 600w, https://images.theconversation.com/files/439898/original/file-20220109-13-4a4va.png?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=510&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/439898/original/file-20220109-13-4a4va.png?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=510&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/439898/original/file-20220109-13-4a4va.png?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=641&fit=crop&dpr=1 754w, https://images.theconversation.com/files/439898/original/file-20220109-13-4a4va.png?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=641&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/439898/original/file-20220109-13-4a4va.png?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=641&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Controlled Colombian site photograph showing geophysical electrical resistivity equipment being used to collect data over the simulated clandestine burials of murder victims (blue and yellow wooden stakes).</span>
<span class="attribution"><span class="license">Author provided</span></span>
</figcaption>
</figure>
<p>From <a href="http://doi.org.uk/10.1111/1556-4029.14962">drone results</a>, we found vegetation changes that indicated recent grave positions if they weren’t under dense forest canopies. Different plants <a href="http://dx.doi.org/10.1016/j.jappgeo.2016.10.002">also grew</a> over the burials when compared to typical forest plants, so these could indicate where bodies are located if search teams knew what they were looking for. </p>
<p>Geophysical results for the test site showed that electrical resistivity surveys could best detect burial positions. But as time passed since burial, this technique got progressively less effective as a grave detection technique (this has been demonstrated in various <a href="https://doi.org/10.1038/s41598-020-64262-3">published European controlled studies</a>). Interestingly, a relatively small survey grid pattern was judged best, due to the smaller burial sizes of dismembered victims. </p>
<h2>Mountain searches</h2>
<p>One recently <a href="https://dx.doi.org/10.1111/1556-4029.14168">published case study</a> by the co-authors on finding missing persons in Colombia from the 1980s illustrates the difficulties in both finding and surveying burial sites in difficult search terrains.</p>
<p>The mountainous study site, in a derelict training school in Casanare province in central Colombia, was identified as a potential burial site. Researchers used a combination of known criminal and paramilitary training locations, military base locations, past police reports and search information as well as contemporary witness testimonies and the missing individual’s social media activities with tagged locations. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/the-science-of-finding-buried-bodies-77803">The science of finding buried bodies</a>
</strong>
</em>
</p>
<hr>
<p>Ground geophysical electrical resistivity and GPR surveys, with subsequent intrusive investigations of the targeted geophysical anomalies, successfully located burials containing remains, but these were found to be animal not human.</p>
<p>This ongoing collaborative research of both controlled test sites and forensic searches will be crucial, not only for Latin American countries, but also for forensic investigators searching for victim remains globally.</p><img src="https://counter.theconversation.com/content/174600/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Jamie Pringle receives funding from the HLF, the Nuffield Foundation, Royal Society, NERC, EPSRC and EU Horizon2020. He is affiliated with the Geological Society of London. Jamie works for Keele University.</span></em></p><p class="fine-print"><em><span>Alejandra Baena receives funding from American Academy of Forensic Science. She is affiliated with International Net of Forensic Researchers (Red Iberoamérica de Investigadores Forenses - RIIF). Alejandra works for Universidad Antonio Nariño, Colombia, South America.</span></em></p><p class="fine-print"><em><span>Carlos Martín Molina Gallego receives funding from:
American Academy of Forensic Sciences.
International Union of Geological Sciences - Initiative on Forensic Geology (IUGS-IFG), which linked him as "Official for Latin America".
International Net of Forensics Resarchers (Red Iberoamericana de Investigadores Forenses)
Carlos works for Universidad Antono Nariño, Colombia, Sur América.
</span></em></p><p class="fine-print"><em><span>Kristopher Wisniewski is affiliated with the Geological Society of London.</span></em></p><p class="fine-print"><em><span>Vivienne Heaton does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>Researchers are using modern forensic techniques to find the bodies of victims of civil conflict in Latin America.Jamie Pringle, Senior Lecturer in Geosciences, Keele UniversityAlejandra Baena, Researcher in Materials Physics, Geophysics and Materials Science., Universidad Antonio NariñoCarlos Martín Molina, Researcher Professor, Universidad Antonio NariñoKristopher Wisniewski, Lecturer in Forensic Science, Keele UniversityVivienne Heaton, Lecturer in Forensic Anthropology and Biology, Keele UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1733342021-12-13T03:04:00Z2021-12-13T03:04:00ZNew technology lets police link DNA to appearance and ancestry – and it’s coming to Australia<figure><img src="https://images.theconversation.com/files/436718/original/file-20211209-27-syhopf.jpg?ixlib=rb-1.1.0&rect=17%2C2%2C1899%2C1074&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">
</span> <span class="attribution"><span class="source">Helmut Straisil / Pixabay / James Hereward / Caitlin Curtis</span></span></figcaption></figure><p>The Australian Federal Police recently <a href="https://www.afp.gov.au/news-media/media-releases/advanced-technology-allows-afp-predict-criminal-profiles-dna">announced</a> plans to use DNA samples collected at crime scenes to make predictions about potential suspects.</p>
<p>This technology, called forensic “DNA phenotyping”, can reveal a surprising and growing amount of highly personal information from the traces of DNA that we all leave behind, everywhere we go – including information about our biological sex, ancestry and appearance.</p>
<p>Queensland police have already used versions of this approach to <a href="https://www.smh.com.au/national/drawing-an-offenders-face-from-a-drop-of-blood-20161118-gss377.html">identify a suspect</a> and <a href="https://mypolice.qld.gov.au/news/2020/08/19/police-renew-appeal-to-identify-deceased-man-found-at-nambour-in-2008/">identify remains</a>. Forensic services in <a href="https://www.tandfonline.com/doi/full/10.1080/00450618.2020.1781251">Queensland</a> and <a href="https://www.frontiersin.org/articles/10.3389/fgene.2020.568701/full">New South Wales</a> have also investigated the use of predictive DNA.</p>
<p>This technology can reveal much more about a suspect than previous DNA forensics methods. But how does it work? What are the ethical issues? And what approaches are other countries around the world taking?</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/dna-facial-prediction-could-make-protecting-your-privacy-more-difficult-94740">DNA facial prediction could make protecting your privacy more difficult</a>
</strong>
</em>
</p>
<hr>
<h2>How does it work?</h2>
<p>The AFP plans to implement forensic DNA phenotyping based on an underlying technology called “massively parallel sequencing”. </p>
<p>Our genetic information is encoded in our DNA as long strings of four different base molecules, and sequencing is the process of “reading” the sequence of these bases. </p>
<p>Older DNA sequencing machines could only read one bit of DNA at a time, but current “massively parallel” machines can read more than <em>six trillion</em> DNA bases in a <a href="https://sapac.illumina.com/science/technology/next-generation-sequencing.html">single run</a>. This creates new possibilities for DNA analysis.</p>
<figure class="align-center ">
<img alt="" src="https://images.theconversation.com/files/436846/original/file-20211210-140109-gsqlie.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/436846/original/file-20211210-140109-gsqlie.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=270&fit=crop&dpr=1 600w, https://images.theconversation.com/files/436846/original/file-20211210-140109-gsqlie.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=270&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/436846/original/file-20211210-140109-gsqlie.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=270&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/436846/original/file-20211210-140109-gsqlie.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=339&fit=crop&dpr=1 754w, https://images.theconversation.com/files/436846/original/file-20211210-140109-gsqlie.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=339&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/436846/original/file-20211210-140109-gsqlie.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=339&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">Massively parallel DNA sequencing has opened new frontiers for genetic analysis.</span>
<span class="attribution"><span class="source">Shutterstock</span></span>
</figcaption>
</figure>
<p>DNA forensics used to rely on a system that matched samples to ones in a criminal DNA database, and did not reveal much beyond identity. However, <a href="https://www.sciencedirect.com/science/article/abs/pii/S1355030617301156">predictive DNA forensics</a> can reveal things like physical appearance, biological sex and ancestry – regardless of whether people are in a database or not. </p>
<p>This makes it <a href="https://pubmed.ncbi.nlm.nih.gov/25716572/">useful</a> in <a href="https://www.missingpersons.gov.au/sites/default/files/National%20DNA%20Program%20for%20Unidentified%20and%20Missing%20Persons%20%20Forensic%20Techniques.pdf">missing persons cases</a> and the investigation of <a href="https://www.missingpersons.gov.au/sites/default/files/National%20DNA%20Program%20for%20Unidentified%20and%20Missing%20Persons%20%20Forensic%20Techniques.pdf">unidentified remains</a>. This method can also be used in criminal cases, mostly to exclude persons of interest. </p>
<p>The AFP plans to predict biological sex, “<a href="https://www.sciencedirect.com/science/article/abs/pii/S1369848614000570">biogeographical ancestry</a>”, eye colour and, in coming months, hair colour. Over the <a href="https://www.afp.gov.au/news-media/media-releases/advanced-technology-allows-afp-predict-criminal-profiles-dna">next decade</a> they aim to include traits such as age, body mass index, and height, and even finer predictions for facial metrics such as distance between the eyes, eye, nose and ear shape, lip fullness, and cheek structure. </p>
<h2>Are there any issues or ethical concerns?</h2>
<p>DNA can reveal highly sensitive information about us. Beyond ancestry and externally visible characteristics, we can predict many other things including aspects of both <a href="https://www.nature.com/articles/s41380-018-0030-8">physical</a> and <a href="https://www.nature.com/articles/mp200833">mental</a> health.</p>
<p>It will be important to set clear boundaries around what can and can’t be predicted in these tests – and when and how they will be used. Despite some progress toward a <a href="https://www.sciencedirect.com/science/article/pii/S1872497318301418">privacy impact assessment</a>, Australian forensic legislation does not currently provide any form of comprehensive <a href="https://www.tandfonline.com/doi/full/10.1080/00450618.2019.1569132">regulation of forensic DNA phenotyping</a>.</p>
<p>The highly sensitive nature of DNA data, and the difficulty in ever making it <a href="https://theconversation.com/dramatic-advances-in-forensics-expose-the-need-for-genetic-data-legislation-105397">anonymous</a> creates significant <a href="https://pubmed.ncbi.nlm.nih.gov/29554642/">privacy</a> concerns. </p>
<p>According to a 2020 government survey about <a href="https://www.oaic.gov.au/engage-with-us/research/australian-community-attitudes-to-privacy-survey-2020-landing-page/2020-australian-community-attitudes-to-privacy-survey">public attitudes to privacy</a>, most Australians are uncomfortable with the idea of their DNA data being collected.</p>
<p>Using DNA for forensics may also <a href="https://www.nature.com/articles/s41436-018-0396-7">reduce public trust</a> in the use of genomics for medical and other purposes.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/dramatic-advances-in-forensics-expose-the-need-for-genetic-data-legislation-105397">Dramatic advances in forensics expose the need for genetic data legislation</a>
</strong>
</em>
</p>
<hr>
<p>The AFP’s planned tests include <a href="https://www.afp.gov.au/news-media/media-releases/advanced-technology-allows-afp-predict-criminal-profiles-dna">biogeographical ancestry prediction</a>. Even when not explicitly tested, DNA data is tightly linked to our ancestry. </p>
<p>One of the biggest risks with any DNA data is exacerbating or creating racial biases. This is especially the case in law enforcement, where <a href="https://www.visage-h2020.eu/PDF/Recommendations_for_website.pdf">specific groups of people may be targeted</a> or stigmatised based on pre-existing biases. </p>
<p>In Australia, <a href="https://www.sbs.com.au/news/after-new-allegations-indigenous-legal-expert-says-racial-profiling-by-police-is-still-very-common/bea8c809-7d38-4ce5-aae3-a066a60ea5b0">Indigenous legal experts report</a> that not enough is being done to fully eradicate racism and unconscious bias within police. Concerns have been raised about other types of <a href="https://www.tandfonline.com/doi/full/10.1080/1323238X.2021.1872132">potential institutional racial profiling</a>. A recent analysis by the ANU also indicated that <a href="https://www.anu.edu.au/news/all-news/three-in-four-people-hold-negative-view-of-indigenous-people">3 in 4 people</a> held implicit negative or unconscious bias against Indigenous Australians.</p>
<p>Careful consideration, consultation, and clear regulatory safeguards need to be in place to ensure these methods are only used to exclude persons of interest rather than include or target specific groups.</p>
<p>DNA data also has inherent risks around misinterpretation. People put a lot of <a href="https://www.cambridge.org/core/journals/law-and-social-inquiry/article/abs/science-and-the-death-penalty-dna-innocence-and-the-debate-over-capital-punishment-in-the-united-states/A5A6C1FE1911211749174038A06EA4C9">trust in DNA evidence</a>, even though it often gives <a href="https://www.tandfonline.com/doi/abs/10.1080/00450610609410635">probabilistic</a> findings which can be difficult to interpret.</p>
<h2>What are other countries doing?</h2>
<p>Predictive DNA forensics is a relatively new field, and countries across Europe have taken different approaches regarding how and when it should be used. A <a href="https://www.aerzteblatt.de/int/archive/article/211421">2019 study</a> across 24 European countries found ten had allowed the use of this technology for practical purposes, seven had not allowed it, and seven more had not yet made a clear determination on its use. </p>
<figure class="align-center ">
<img alt="" src="https://images.theconversation.com/files/436894/original/file-20211210-25-pv5nkc.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/436894/original/file-20211210-25-pv5nkc.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=397&fit=crop&dpr=1 600w, https://images.theconversation.com/files/436894/original/file-20211210-25-pv5nkc.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=397&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/436894/original/file-20211210-25-pv5nkc.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=397&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/436894/original/file-20211210-25-pv5nkc.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=499&fit=crop&dpr=1 754w, https://images.theconversation.com/files/436894/original/file-20211210-25-pv5nkc.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=499&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/436894/original/file-20211210-25-pv5nkc.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=499&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">DNA-based prediction is used in some European countries and forbidden in others.</span>
<span class="attribution"><a class="source" href="https://www.aerzteblatt.de/int/archive/article/211421">Adapted from Schneider, Prainsack & Kayser/Dtsch Arztebl Int.</a></span>
</figcaption>
</figure>
<p><a href="https://www.visage-h2020.eu/PDF/Recommendations_for_website.pdf">Germany</a> allows the prediction of externally visible characteristics (including skin colour), but has decided biogeographical ancestry is simply too risky to be used. </p>
<p>The one exception to this is the state of <a href="https://www.jura.fu-berlin.de/studium/lawclinic/publikationen/Push-for-Forensic-DNA-Phenotyping_-Ancestry-Testing-in-Germany-Raises-Dicrimination-Concerns.pdf">Bavaria</a>, where ancestry can be used to avert imminent danger, but not to investigate crimes that have already occurred.</p>
<p>A UK advisory panel made four <a href="https://www.gov.uk/government/publications/biometrics-and-forensics-ethics-group-annual-report-2019/biometrics-and-forensic-ethics-group-annual-report-2019-accessible-version#commission">recommendations</a> last year. These include the need to clearly explain how the data is used, presenting ancestral and phenotypic data as probabilities so uncertainty can be evaluated, and clearly explaining how judgements would be made about when to use the technology and who would make the decision. </p>
<p>The <a href="https://www.visage-h2020.eu/PDF/Recommendations_for_website.pdf">VISAGE consortium</a> of academics, police and justice institutions, from eight European countries, also produced a report of recommendations and concerns in 2020. </p>
<p>They urge careful consideration of the circumstances where DNA phenotyping should be used, and the definition of a “serious crime”. They also highlight the importance of a governing body with responsibility for deciding when and how the technology should be used.</p>
<h2>Safeguarding public trust</h2>
<p>The AFP press release mentions it is mindful of maintaining public trust, and has implemented privacy processes. <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6976916/">Transparency and proportionate use</a> will be crucial to keep the public on board as this technology is rolled out. </p>
<p>This is a rapidly evolving field and Australia needs to develop clear and coherent policy that is able to keep up with the pace of technological developments - and considers community concerns.</p>
<hr>
<p><em>Correction: this article originally stated that “gender” can be predicted from DNA. This has now been corrected to “biological sex”.</em></p><img src="https://counter.theconversation.com/content/173334/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Caitlin Curtis receives funding from the National Health and Medical Research Council (NHMRC).</span></em></p><p class="fine-print"><em><span>James Hereward does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>The Australia Federal Police is set to start using controversial technology that predicts the ancestry and appearance of suspects from DNA samples.Caitlin Curtis, Research fellow, The University of QueenslandJames Hereward, Research fellow, The University of QueenslandLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1719592021-11-18T02:19:57Z2021-11-18T02:19:57ZHow do police forensic scientists investigate a case? A clandestine gravesite recovery expert explains<figure><img src="https://images.theconversation.com/files/432536/original/file-20211117-17-12mhnhc.jpg?ixlib=rb-1.1.0&rect=0%2C0%2C5729%2C3739&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">
</span> <span class="attribution"><span class="source">Brendan Chapman</span>, <span class="license">Author provided</span></span></figcaption></figure><p>Recent high-profile missing persons cases, including that of William Tyrrell – who went missing in Kendall, New South Wales, at the age of three in 2014 – have focused public attention on the forensic practices involved in crime scene investigations. </p>
<p>As a forensic scientist who has worked at thousands of homicide, sexual assault and serious crime scenes, I can tell you this process is not as straightforward as depicted on popular true crime shows.</p>
<p>I <a href="https://scholar.google.com.au/citations?user=RxkDXXAAAAAJ&hl=en">research</a> and teach <a href="https://www.murdoch.edu.au/thisisfreethinking/home">forensic science at Murdoch University</a> and specialise in <a href="https://www.murdoch.edu.au/news/articles/cold-case-review-at-murdoch">cold-case</a> techniques and clandestine gravesite recovery. Here’s what typically happens behind the lines of police tape when forensic teams are at work.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/this-is-going-to-affect-how-we-determine-time-since-death-how-studying-body-donors-in-the-bush-is-changing-forensic-science-117662">'This is going to affect how we determine time since death': how studying body donors in the bush is changing forensic science</a>
</strong>
</em>
</p>
<hr>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/432534/original/file-20211117-17-a8pr7v.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/432534/original/file-20211117-17-a8pr7v.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/432534/original/file-20211117-17-a8pr7v.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/432534/original/file-20211117-17-a8pr7v.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/432534/original/file-20211117-17-a8pr7v.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/432534/original/file-20211117-17-a8pr7v.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/432534/original/file-20211117-17-a8pr7v.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/432534/original/file-20211117-17-a8pr7v.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">The author teaches students clandestine grave site evidence collection techniques to Murdoch University students.</span>
<span class="attribution"><span class="source">Brendan Chapman</span>, <span class="license">Author provided</span></span>
</figcaption>
</figure>
<h2>The crucial first moments</h2>
<p>In the first moments after a major crime, what has happened is often a mystery. </p>
<p>Like a scene from a painting, it’s as if time stood still; many regular household items sit as they did before the violent event took place. Investigators take great care not to disturb the initial scene, lest valuable evidence be lost.</p>
<p>The first task is to record everything as it appears in incredible detail – by video, photo and in written notes. Even items that may first appear innocuous can later take on new significance.</p>
<p>This stage is vital; years later, this may be the only way cold-case teams can virtually revisit the scene to identify new clues. </p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/432531/original/file-20211117-28-9dneev.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/432531/original/file-20211117-28-9dneev.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/432531/original/file-20211117-28-9dneev.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/432531/original/file-20211117-28-9dneev.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/432531/original/file-20211117-28-9dneev.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/432531/original/file-20211117-28-9dneev.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/432531/original/file-20211117-28-9dneev.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/432531/original/file-20211117-28-9dneev.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">The first task, before anything in the scene is disturbed, is to record everything as it appears.</span>
<span class="attribution"><span class="source">Brendan Chapman</span>, <span class="license">Author provided</span></span>
</figcaption>
</figure>
<h2>Evidence testing and collection</h2>
<p>As the forensic investigation unfolds, information and evidence are gathered and given to investigators at the crime scene. This helps provide context to guide the search for evidence.</p>
<p>The crime scene team works meticulously to identify and “field-test” items (meaning tests are done in situ) before securing them in bags. </p>
<p>In some cases, that’s by using chemicals and testing kits to identify body fluids or other traces associated with the crime. </p>
<p>We also use some very high-tech torches that can emit a specific type to light to help us see otherwise invisible clues. This works a bit like the lighting in nightclubs that might expose lint on your black outfit.</p>
<p>At this stage, the best crime scene examiners invoke the scientific method, proposing <a href="https://wires.onlinelibrary.wiley.com/doi/10.1002/widm.1354">hypotheses</a> as to what has happened, and then searching for evidence that may refute their suggestion. </p>
<p>Theories are presented and then ruled out in place of new theories as new evidence emerges. </p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/432295/original/file-20211116-27-102xibz.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/432295/original/file-20211116-27-102xibz.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/432295/original/file-20211116-27-102xibz.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/432295/original/file-20211116-27-102xibz.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/432295/original/file-20211116-27-102xibz.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/432295/original/file-20211116-27-102xibz.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/432295/original/file-20211116-27-102xibz.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/432295/original/file-20211116-27-102xibz.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">The crime scene team works meticulously to identify and field test items of evidence before securing them in bags.</span>
<span class="attribution"><span class="source">Shutterstock</span></span>
</figcaption>
</figure>
<h2>Testing for traces of blood, semen and other body fluids</h2>
<p>On the scene, forensic investigators have a suite of tools to help identify body fluids such as semen and blood.</p>
<p>The <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2523691/?page=1">Kastle–Meyer test</a>, deployed to test for the possible presence of blood, has been used since the early 20th century.</p>
<p>A chemical called phenolophthalin is dropped onto the suspected sample, followed quickly by a drop of hydrogen peroxide. These chemicals can detect the blood ingredient haemoglobin. If it rapidly turns pink, there’s a good chance there’s blood in the sample.</p>
<p>A different method called the acid phosphatase test, which can detect an enzyme secreted from the prostate gland, is used to identify the presence of semen. A prepared chemical is dropped onto a sample of the suspected stain; a colour change from clear to dark purple suggests the likely presence of semen.</p>
<p>You may also have heard of investigators using <a href="https://www.abc.net.au/news/2021-11-17/william-tyrrell-investigation-technology-explained/100626684">luminol</a>, which can detect old blood stains or traces a person has tried to scrub away. The investigator sprays luminol and other chemicals on a darkened area; a blue glow suggests traces of blood may be present.</p>
<p>For all these tests, and everything we do as forensic investigators, meticulous records are kept about both observations and ideas. These notes will eventually become part of the huge case file that goes to court. </p>
<h2>Different types of forensic experts work together</h2>
<p>There are many different types of specialist crime scene investigators, such as:</p>
<ul>
<li><p><strong>fingerprint specialists</strong>, who use chemicals and powders to visualise fingerprints invisible to the naked eye and determine if they’re good enough to compare with prints on a database</p></li>
<li><p><strong>bloodstain pattern analysis experts</strong> who, like Dexter from the eponymous crime show, observe the shape of blood droplets or marks in an effort to reconstruct a bloodshed scenario</p></li>
<li><p><strong>physical evidence comparison experts</strong>, who record evidence such as shoe impressions or tool marks to compare with objects at the scene (for example, was <em>this</em> screwdriver used to create <em>that</em> mark on a window frame?)</p></li>
<li><p><strong>ballistics and firearms experts</strong>, who identify and analyse evidence such as gunshot residues and fired bullets. They can also reconstruct shooting events to determine trajectories and distances</p></li>
<li><p><strong>clandestine grave recovery experts</strong> (like me!), whose knowledge of the natural processes after death can help <a href="https://link.springer.com/article/10.1007/s11896-021-09457-8?wt_mc=Internal.Event.1.SEM.ArticleAuthorOnlineFirst&utm_source=ArticleAuthorOnlineFirst&utm_medium=email&utm_content=AA_en_06082018&ArticleAuthorOnlineFirst_20210521">locate and exhume grave sites</a> using painstakingly careful archaeological approaches. </p></li>
</ul>
<p>Other specialised forensic practitioners include pathologists, <a href="https://theconversation.com/trust-me-im-an-expert-forensic-entomology-or-what-bugs-can-tell-police-about-when-someone-died-124416">insect experts</a>, anthropologists, biologists and chemists. </p>
<p>Forensic investigations are most successful with a <a href="https://www.emerald.com/insight/content/doi/10.1108/JCP-09-2019-0038/full/html">multidisciplinary</a> team, which allows for many different opinions and ideas. </p>
<p>Specialists must work together to ensure one person’s evidence-collection method doesn’t ruin another specialist’s chance to use their own techniques.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/trust-me-im-an-expert-forensic-entomology-or-what-bugs-can-tell-police-about-when-someone-died-124416">Trust Me, I'm An Expert: forensic entomology, or what bugs can tell police about when someone died</a>
</strong>
</em>
</p>
<hr>
<h2>Clandestine gravesites</h2>
<p>Outdoor scenes present extra challenges, as evidence can be damaged or destroyed by weather, wildlife and the landscape itself. Clandestine gravesites, however, can help preserve clues underground.</p>
<p>It’s not easy to find a hidden burial site; even a freshly dug gravesite, if done well, can be difficult to identify in an expansive bush scene. </p>
<p>Investigators will be looking for areas where the ground looks disturbed or spots where vegetation has grown unusually lushly (caused by the decomposition of a body underneath).</p>
<p>Investigators may also deploy cadaver dogs to search for human remains, or <a href="https://www.abc.net.au/news/2021-11-17/william-tyrrell-investigation-technology-explained/100626684">ground-penetrating radar</a>, which uses radio waves to identify changes in the soil underground.</p>
<p>Once a grave is identified, you can’t just roughly dig it up; the grave fill must be gradually removed using small brushes and shovels, like those used on archaeological dig sites.</p>
<p>All removed soil is sifted and searched for tiny pieces of evidence; even a tiny fibre or hair could connect the grave to a suspect. </p>
<p>Even the sidewalls of the grave can offer clues about the type or shape of the shovel used to dig it. </p>
<p>Layer by layer, we work down until we reveal the deceased person at the bottom of the grave. Utmost care is taken here, as repatriation of the remains to loved ones is a pivotal part of the process of gaining closure.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/432533/original/file-20211117-23-qhvavi.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="" src="https://images.theconversation.com/files/432533/original/file-20211117-23-qhvavi.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/432533/original/file-20211117-23-qhvavi.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/432533/original/file-20211117-23-qhvavi.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/432533/original/file-20211117-23-qhvavi.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/432533/original/file-20211117-23-qhvavi.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/432533/original/file-20211117-23-qhvavi.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/432533/original/file-20211117-23-qhvavi.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">It’s not easy to find a hidden burial site; even a freshly dug gravesite, if done well, can be very difficult to identify in an expansive bush scene.</span>
<span class="attribution"><span class="source">Brendan Chapman</span>, <span class="license">Author provided</span></span>
</figcaption>
</figure>
<h2>Time is of the essence</h2>
<p>All evidence has a life span. The sooner forensic scientists can identify and analyse a piece of evidence, the better the chances are of it producing a result. </p>
<p>This can be one of the greatest challenges in a cold case, where a crime scene has been changed by the elements over many years.</p><img src="https://counter.theconversation.com/content/171959/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Brendan Chapman does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.</span></em></p>As a forensic scientist who has worked at thousands of homicide, sexual assault and serious crime scenes, I can tell you the process is not as straightforward as depicted on popular true crime shows.Brendan Chapman, Senior Lecturer in Forensic Science, Murdoch UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1616862021-08-18T18:26:48Z2021-08-18T18:26:48ZWe trained AI to recognise footprints, but it won’t replace forensic experts yet<figure><img src="https://images.theconversation.com/files/405926/original/file-20210611-23-1xdb1cf.jpg?ixlib=rb-1.1.0&rect=251%2C233%2C3544%2C1982&q=45&auto=format&w=496&fit=clip" /><figcaption><span class="caption">
</span> <span class="attribution"><a class="source" href="https://www.shutterstock.com/image-photo/black-wet-footprints-over-gray-pedestrian-638543815">Shutterstock/Evannovostro</a></span></figcaption></figure><p>We rely on experts all the time. If you need financial advice, you ask an expert. If you are sick, you visit a doctor, and as a juror you may listen to an expert witness. In the future, however, artificial intelligence (AI) might replace many of these people. </p>
<p>In forensic science, the expert witness plays a vital role. Lawyers seek them out for their analysis and opinion on specialist evidence. But experts are human, with all their failings, and the role of expert witnesses has frequently been <a href="https://doi.org/10.1073/pnas.1712161115">linked to</a> miscarriages of justice.</p>
<p>We’ve been investigating the potential for AI to study evidence in forensic science. In two recent papers, we found AI was better at assessing footprints than general forensic scientists, but not better than specific footprint experts.</p>
<h2>What’s in a footprint?</h2>
<p>As you walk around your home barefoot you leave footprints, as <a href="https://doi.org/10.1111/1556-4029.14718">indentations in your carpet</a> or as residue from your feet. Bloody footprints are common at violent crime scenes. They allow investigators to reconstruct events and perhaps profile an unknown suspect.</p>
<p>Shoe prints are one of the <a href="https://doi.org/10.1111/1556-4029.14662">most common</a> types of evidence, especially <a href="https://doi.org/10.1016/j.scijus.2021.04.003">at domestic burglaries</a>. These traces are recovered from windowsills, doors, toilet seats and floors and may be visible to or hidden from the naked eye. In the UK, recovered marks are analysed by police forces and used to search <a href="https://www.policeprofessional.com/news/the-national-footwear-reference-collection-nfrc/">a database</a> of footwear patterns.</p>
<p>The size of barefoot prints can tell you about a suspect’s height, weight, and even gender. In a<a href="https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0255630"> recent study</a>, we asked an expert podiatrist to determine the gender of a bunch of footprints and they got it right just over 50% of the time. We then created a neural network, a form of AI, and asked it to do the same thing. It got it right around 90% of the time. What’s more, much to our surprise, it could also assign an age to the track-maker at least to the nearest decade.</p>
<figure class="align-center ">
<img alt="A series of footprints with a heat map over them." src="https://images.theconversation.com/files/405889/original/file-20210611-17-1wr8c6w.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/405889/original/file-20210611-17-1wr8c6w.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=368&fit=crop&dpr=1 600w, https://images.theconversation.com/files/405889/original/file-20210611-17-1wr8c6w.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=368&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/405889/original/file-20210611-17-1wr8c6w.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=368&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/405889/original/file-20210611-17-1wr8c6w.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=463&fit=crop&dpr=1 754w, https://images.theconversation.com/files/405889/original/file-20210611-17-1wr8c6w.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=463&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/405889/original/file-20210611-17-1wr8c6w.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=463&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px">
<figcaption>
<span class="caption">The footprints analysed by the Bluestar AI, with a heat map over them suggesting areas of ambiguity.</span>
<span class="attribution"><span class="source">Matthew Bennett</span>, <span class="license">Author provided</span></span>
</figcaption>
</figure>
<p>When it comes to shoe prints, footwear experts can identify the make and model of a shoe simply by experience – it’s second nature to these experts and mistakes are rare. Anecdotally, we’ve been told there are fewer than 30 footwear experts in the UK today. However, there are thousands of forensic and police personnel in the UK who are casual users of the the footwear database. For these casual users, analysing footwear can be challenging and their work often needs to be verified by an expert. For that reason, we thought AI may be able to help.</p>
<p>We tasked a second neural network, developed as part of an ongoing partnership with UK-based <a href="https://doi.org/10.1016/j.asoc.2021.107496">Bluestar Software</a>, with identifying the make and model of footwear impressions. This AI takes a black and white footwear impression and automatically recognises the shape of component treads. Are the component treads square, triangular or circular? Is there a logo or writing on the shoe impression? Each of these shapes corresponds to a code in a simple classification. It is these codes that are used to search the database. In fact the AI gives a series of suggested codes for the user to verify and identifies areas of ambiguity that need checking.</p>
<p>In one of our experiments, an occasional user was given 100 randomly selected shoe prints to analyse. Across the trial, which we ran several times, the casual user got it right between 22% and 83% of the time. In comparison the AI was between 60% and 91% successful. Footwear experts, however, are right nearly 100% of the time. </p>
<p>One reason why our second neural network was not perfect and didn’t outperform real experts is that shoes vary with wear, making the task more complex. Buy a new pair of shoes and the tread is sharp and clear but after a month or two it becomes less clear. But while the AI couldn’t replace the expert trained to spot these things it did outperform occasional users, suggesting it could help free up time for the expert to focus on more difficult cases. </p>
<h2>Will AI replace experts?</h2>
<p>Systems like this increase the accuracy of footwear evidence and we will probably see it used more often than it is currently – especially in intelligence-led policing that aims to link crimes and reduce the cost of domestic burglaries. In the UK alone they cost on average £5,930 per incident in 2018, which amounts to <a href="https://www.gov.uk/government/publications/the-economic-and-social-costs-of-crime">a total economic cost</a> of £4.1 billion. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/it-takes-a-lot-of-energy-for-machines-to-learn-heres-why-ai-is-so-power-hungry-151825">It takes a lot of energy for machines to learn – here's why AI is so power-hungry</a>
</strong>
</em>
</p>
<hr>
<p>AI will never replace the skilled and experienced judgement of a well-trained footwear examiner. But it might help by reducing the burden on those experts and allow them to focus on the difficult cases by helping the casual users to identify the make and model of a footprint more reliably on their own. At the same time, the experts who use this AI will replace the ones who don’t.</p><img src="https://counter.theconversation.com/content/161686/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Matthew Robert Bennett receives funding from the UK Knowledge Transfer Partnership (KTP). </span></em></p><p class="fine-print"><em><span>Marcin Budka receives funding from Innovate UK via the Knowledge Transfer Partnership (KTP) programme.</span></em></p>Artificial intelligence could help police catch criminals – but we need human experts for the big cases.Matthew Robert Bennett, Professor of Environmental and Geographical Sciences, Bournemouth UniversityMarcin Budka, Professor of Data Science, Bournemouth UniversityLicensed as Creative Commons – attribution, no derivatives.tag:theconversation.com,2011:article/1564872021-03-04T08:52:44Z2021-03-04T08:52:44ZKathleen Folbigg’s children likely died of natural causes, not murder. Here’s the evidence my team found<p>Some 90 prominent scientists, including Nobel laureates and other leading Australian and international researchers, <a href="https://www.theguardian.com/australia-news/2021/mar/04/scientists-call-for-kathleen-folbiggs-release-saying-children-likely-died-of-natural-causes">today called for</a> convicted child murderer Kathleen Folbigg <a href="https://www.science.org.au/news-and-events/news-and-media-releases/leading-scientists-call-folbigg-pardon">to be pardoned</a> and released from jail.</p>
<p><div data-react-class="Tweet" data-react-props="{"tweetId":"1367214852624633858"}"></div></p>
<p>They say <a href="https://academic.oup.com/europace/advance-article/doi/10.1093/europace/euaa272/5983835#212361099">genetic evidence</a> published in November 2020 shows some of the children had genetic mutations that predisposed them to heart complications. They argue these mutations are what likely led to their deaths. </p>
<p>This evidence was not available at the time of Folbigg’s conviction in 2003. Instead, she was convicted of smothering her children. She remains in jail and maintains her innocence.</p>
<p>I was one of the scientists who published the genetic evidence behind today’s petition to pardon Folbigg, which I signed. I was also an unpaid expert witness in the recent judicial inquiry into her conviction. Here is what our genetic analysis found. Here is also what I learned from my experience as a first-time expert witness.</p>
<h2>Conviction and inquiry</h2>
<p>In 2003, Folbigg was convicted of murdering her children Patrick, Sarah and Laura, and of manslaughter of Caleb. They ranged in age from 19 days to 18 months when they died.</p>
<p>Based on existing medical and pathological evidence, a petition to re-examine the possibility the children had died of natural causes led to a judicial inquiry, which was heard in April 2019.</p>
<p>The inquiry heard Sarah and Laura had a never-before reported mutation in the <a href="https://www.genecards.org/cgi-bin/carddisp.pl?gene=CALM2"><em>CALM2</em> gene</a>, which controls how calcium is transported in and out of heart cells. Mutations in this gene are one of the <a href="https://www.nature.com/articles/s41572-020-0188-7">best-recognised causes</a> of sudden death in infancy and childhood.</p>
<p>In May 2019, after the hearings had concluded, a similar mutation in two siblings in the United States caused one of them to die of an irregular heartbeat (cardiac arrhythmia) and the other to have a heart attack (cardiac arrest). </p>
<p>Based on this evidence and before the judge made his findings, we wrote a report concluding this mutation was likely to be the cause of Sarah and Laura’s deaths. World experts in the genetics of cardiac arrhythmias (<a href="https://esc365.escardio.org/Person/288-prof-schwartz-peter">Professor Peter Schwartz</a>) and of cardiac conditions caused by <em>CALM</em> genes (<a href="https://vbn.aau.dk/en/persons/118878">Professor Michael Toft Overgaard</a>), endorsed this conclusion and alluded to the need to reopen the inquiry to further discuss the mutation. </p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/what-causes-sids-what-we-know-dont-know-and-suspect-86544">What causes SIDS? What we know, don’t know and suspect</a>
</strong>
</em>
</p>
<hr>
<p>In July 2019, the inquiry found there was no reasonable doubt as to Folbigg’s conviction, based principally on interpretation of her diaries and the rarity of many cases of SIDS (sudden infant death syndrome) in one family.</p>
<p>Since then, I was part of an international group of researchers who has <a href="https://academic.oup.com/europace/advance-article/doi/10.1093/europace/euaa272/5983835#212361099">published further evidence</a> showing the <em>CALM2</em> mutation impairs how calcium is transported. We also found it is as severe as other known <em>CALM</em> mutations that cause sudden death in infants and children, while awake or asleep. </p>
<p>We concluded that mutations in the female Folbigg children likely led to disruptions in their heartbeats resulting in sudden cardiac death.</p>
<figure>
<iframe src="https://player.vimeo.com/video/518533234" width="500" height="281" frameborder="0" webkitallowfullscreen="" mozallowfullscreen="" allowfullscreen=""></iframe>
<figcaption><span class="caption">Here’s why scientists are calling for a pardon.</span></figcaption>
</figure>
<h2>Let’s unpack that genetic evidence</h2>
<p>At the time of the 2003 trial, genomics was in its infancy and the geneticists involved in the case could not find a genetic cause for any of the children’s deaths.</p>
<p>However, in 2018, I was approached by Folbigg’s solicitors and asked whether current gene sequencing technologies would now enable finding a possible genetic cause for their deaths. This was indeed possible: in the past decade numerous genetic causes of sudden unexpected deaths have been discovered. </p>
<p>My team first sequenced Folbigg’s genome from saliva and swabs taken from the inside of her cheek, since there was a possibility she was a carrier of one of these mutations. We were surprised to find she had the never-before reported CALM2 mutation. </p>
<p>In early 2019, I was officially asked to form part of a team of geneticists to analyse the genomes of Folbigg and her children as part of the inquiry into her convictions.</p>
<p>From a technical perspective, it was an incredible achievement. The <a href="https://www.vcgs.org.au/">Victorian Clinical Genetics Service</a> sequenced the entire genomes of two of the children from blood samples on <a href="https://www.betterhealth.vic.gov.au/health/conditionsandtreatments/newborn-screening">heel-prick cards</a> babies typically have at birth. These samples were more than 20 years old. Frozen tissue and immortalised cells were available from the other two children.</p>
<figure class="align-center zoomable">
<a href="https://images.theconversation.com/files/387636/original/file-20210304-15-a0yjn9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=1000&fit=clip"><img alt="Newborn getting heel-prick test" src="https://images.theconversation.com/files/387636/original/file-20210304-15-a0yjn9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip" srcset="https://images.theconversation.com/files/387636/original/file-20210304-15-a0yjn9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=600&h=400&fit=crop&dpr=1 600w, https://images.theconversation.com/files/387636/original/file-20210304-15-a0yjn9.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=600&h=400&fit=crop&dpr=2 1200w, https://images.theconversation.com/files/387636/original/file-20210304-15-a0yjn9.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=600&h=400&fit=crop&dpr=3 1800w, https://images.theconversation.com/files/387636/original/file-20210304-15-a0yjn9.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&h=503&fit=crop&dpr=1 754w, https://images.theconversation.com/files/387636/original/file-20210304-15-a0yjn9.jpg?ixlib=rb-1.1.0&q=30&auto=format&w=754&h=503&fit=crop&dpr=2 1508w, https://images.theconversation.com/files/387636/original/file-20210304-15-a0yjn9.jpg?ixlib=rb-1.1.0&q=15&auto=format&w=754&h=503&fit=crop&dpr=3 2262w" sizes="(min-width: 1466px) 754px, (max-width: 599px) 100vw, (min-width: 600px) 600px, 237px"></a>
<figcaption>
<span class="caption">Researchers analysed blood samples taken when Folbigg’s children were born.</span>
<span class="attribution"><a class="source" href="https://www.shutterstock.com/image-photo/close-details-family-doctor-carries-out-1628211025">from www.shutterstock.com</a></span>
</figcaption>
</figure>
<p>We found the two girls had the same mutation as their mother in the <em>CALM2</em> gene, known as variant G114R.</p>
<p>The <a href="https://academic.oup.com/europace/advance-article/doi/10.1093/europace/euaa272/5983835#212361099">study published</a> into the impact of this variant show it affects the way calcium binds and moves through the heart cells, affecting how the heart muscle contracts.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/explainer-what-happens-during-a-heart-attack-and-how-is-one-diagnosed-55874">Explainer: what happens during a heart attack and how is one diagnosed?</a>
</strong>
</em>
</p>
<hr>
<p>We concluded this variant likely contributed to the natural deaths of the two girls by altering the heart’s normal rhythm. This may have been triggered by infections both girls had around the time they died and the medication they were given, which combined with their mutation, made them particularly susceptible to heart complications. </p>
<p>Laura, in particular, had such extensive myocarditis (inflammation of the heart) that all three professors of forensic pathology present at the 2019 inquiry stated, prior to the hearings on genetic evidence, they <a href="https://www.folbigginquiry.justice.nsw.gov.au/Pages/exhibits.aspx">would have listed Laura’s cause of death as myocarditis</a>.</p>
<p>The two boys also had medical conditions that point towards dying of natural causes. One had difficulty breathing due to a floppy larynx, the other had epilepsy and blindness. </p>
<p>Only recently, as we were re-analysing the Folbigg genomes, we found the two boys had two different novel and rare variants in a gene known as <em>BSN</em> (or <em>Bassoon</em>), one inherited from their mother and the other presumably inherited from their father. </p>
<p>This is a gene that when defective in mice, causes early onset lethal epilepsy — mice die young during epileptic fits. We are currently investigating whether the variants found in the Folbigg boys can cause disease. </p>
<h2>What can we learn from this?</h2>
<p>I have not been involved in any other legal proceedings before the judicial inquiry into Folbigg’s convictions. But I want to talk about my experience as a scientist expert witness.</p>
<p>My experience left me thinking it had several blind spots when it comes to evaluating scientific evidence.</p>
<p>As a scientist and trained medical doctor, I found the procedure of the inquiry bewildering. Even before we made the genetic findings, there was credible medical and pathology evidence to indicate the Folbigg children had died of natural causes.</p>
<p>In this case, and as far as I can tell, Folbigg was selected for investigations because of the rarity of the events, with circumstantial evidence gathered from interpretations of her diaries presented as evidence of her guilt. Such an approach forgets that rare events do occur. And in genetics, one-off events are commonplace.</p>
<p>Then there was the notion of expertise. In the lead-up to the inquiry, I was expecting subject matter experts to be called to give evidence. But there was not a single expert in the genetics of heart arrhythmias, nor an expert in <em>CALM</em> genes.</p>
<hr>
<p>
<em>
<strong>
Read more:
<a href="https://theconversation.com/mad-or-bad-expert-witnesses-and-the-anders-breivik-trial-6403">Mad or bad? Expert witnesses and the Anders Breivik trial</a>
</strong>
</em>
</p>
<hr>
<p>This absence of safeguards to ensure the evidence presented was robust and well-informed made for a negative experience. It has discouraged me from engaging in similar court cases in the future. If my experience is not unique, and this is common, the law runs the real risk that career scientists will not want to engage in legal matters.</p>
<p>If we want scientists to participate in cases involving complex or technical scientific issues, I think we need to improve the process of recruiting expert witnesses. We should be choosing scientists who support their reasoning based on peer-reviewed scientific evidence.</p>
<p>I also hope the experience of giving evidence could be made less combative. I felt intimidated throughout the hearing, being forced to answer yes or no to many questions and being cut off repeatedly. The natural world rarely exists in binary.</p>
<p>If scientists do not feel they are treated as equals to their legal peers, they are unlikely to volunteer their time to assist the court. Instead, the law will be left with only a handful of professional expert witnesses that are unlikely to be representative of their respective fields.</p>
<p>I hope that in coming years, we will see an increased appreciation for the scientific method in a legal setting. Complex cases like this one are likely to become more frequent as our scientific tools improve and increasingly find their way out of the lab and into the courtroom.</p>
<hr>
<p><em>The latter part of this article was based on an edited version of a speech I gave last year to a joint symposium of the <a href="https://academyoflaw.org.au/event-3846889">Australian Academy of Science and the Australian Academy of Law</a>. The original speech is available <a href="https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=&cad=rja&uact=8&ved=2ahUKEwiQr6OM0pXvAhWXyzgGHXQPBsIQFjABegQIAhAD&url=https%3A%2F%2Facademyoflaw.org.au%2Fresources%2FDocuments%2F20200820%2520%5BAfter%2520Event%5D%5BPaper%5D%2520Professor%2520Carola%2520Vinuesa.pdf&usg=AOvVaw2A9OYLblNza2XgOS-OMd-K">here</a>.</em></p><img src="https://counter.theconversation.com/content/156487/count.gif" alt="The Conversation" width="1" height="1" />
<p class="fine-print"><em><span>Carola Garcia de Vinuesa was one of the scientists who published the genetic evidence behind today's petition to pardon Folbigg, which she signed. She was also an unpaid expert witness at the judicial inquiry into her conviction.</span></em></p>The science behind today’s petition to pardon Kathleen Folbigg has been peer reviewed. Here’s what it says.Carola Garcia de Vinuesa, Professor and Co-Director, Centre for Personalised Immunology, NHMRC Centre of Research Excellence, Australian National UniversityLicensed as Creative Commons – attribution, no derivatives.